Miyakogusa Predicted Gene
- Lj0g3v0152709.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0152709.1 Non Chatacterized Hit- tr|G7KNM5|G7KNM5_MEDTR
Uncharacterized protein OS=Medicago truncatula
GN=MTR_,60.27,0.00000000000002,seg,NULL,CUFF.9426.1
(276 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC62008 353 4e-97
gnl|LJGI|TC60376 78 3e-14
>gnl|LJGI|TC62008
Length = 1288
Score = 353 bits (178), Expect = 4e-97
Identities = 178/178 (100%)
Strand = Plus / Plus
Query: 1 atgggttcttgttattcagtccagagaaaaagtgactcagacatgaggctgaaacttgcg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 266 atgggttcttgttattcagtccagagaaaaagtgactcagacatgaggctgaaacttgcg 325
Query: 61 ttttggtccaaaactgacaagcttgtgattcctccatcaccgattaaggagcaacccaaa 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326 ttttggtccaaaactgacaagcttgtgattcctccatcaccgattaaggagcaacccaaa 385
Query: 121 aatggatacttcaattggtcatcgactcggtcaacgaccaacttcacggactacggta 178
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 386 aatggatacttcaattggtcatcgactcggtcaacgaccaacttcacggactacggta 443
>gnl|LJGI|TC60376
Length = 1157
Score = 77.8 bits (39), Expect = 3e-14
Identities = 63/71 (88%)
Strand = Plus / Plus
Query: 61 ttttggtccaaaactgacaagcttgtgattcctccatcaccgattaaggagcaacccaaa 120
||||| |||||||||||||||||||||||||||||| |||| || || || ||||||||
Sbjct: 328 ttttgttccaaaactgacaagcttgtgattcctccaacacccatcaaagaaaaacccaaa 387
Query: 121 aatggatactt 131
|||||| ||||
Sbjct: 388 aatggaaactt 398