Miyakogusa Predicted Gene

Lj0g3v0151949.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0151949.1 tr|A1C872|A1C872_ASPCL Fungal specific
transcription factor domain protein OS=Aspergillus clavatus
(,31.37,7.8,seg,NULL,CUFF.9364.1
         (222 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO005675                                                      78   2e-14
gnl|LJGI|TC67880 weakly similar to UniRef100_O22752 Cluster: MLO...    78   2e-14

>gnl|LJGI|GO005675 
          Length = 537

 Score = 77.8 bits (39), Expect = 2e-14
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 116 cacactgcaatagatcccagatcggagctcctctgtcatcatc 158
           ||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 297 cacactgcaatagatcccagatcggagctcctccgtcatcatc 255


>gnl|LJGI|TC67880 weakly similar to UniRef100_O22752 Cluster: MLO-like protein 7;
           n=1; Arabidopsis thaliana|Rep: MLO-like protein 7 -
           Arabidopsis thaliana (Mouse-ear cress), partial (16%)
          Length = 571

 Score = 77.8 bits (39), Expect = 2e-14
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                              
Query: 10  gcactgttttcatctttattttcatcacccttgagaagagtcttcacaaat 60
           |||||||||||||||| |||| ||||||||| |||||||||||||||||||
Sbjct: 336 gcactgttttcatcttgatttccatcaccctggagaagagtcttcacaaat 386