Miyakogusa Predicted Gene

Lj0g3v0151919.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0151919.2 CUFF.9361.2
         (198 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80009 similar to UniRef100_Q2HSX6 Cluster: Cyclin-lik...   139   7e-33
gnl|LJGI|GO024643 weakly similar to UniRef100_Q2HSX6 Cluster: Cy...    56   8e-08

>gnl|LJGI|TC80009 similar to UniRef100_Q2HSX6 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (17%)
          Length = 906

 Score =  139 bits (70), Expect = 7e-33
 Identities = 142/166 (85%)
 Strand = Plus / Plus

                                                                       
Query: 19  tgggaaaagctgagacgttcctcggttgaaacccctccatgtgttcgttacgtctctgat 78
           ||||||| |||||||| |||| | |||| ||||||||||||  || || |||||||||| 
Sbjct: 257 tgggaaaggctgagactttccccagttgcaacccctccatgcttttgtcacgtctctgac 316

                                                                       
Query: 79  tgtttggaagacttaaagcccggtgatcatattgagatccaatgcaagctaatggttgaa 138
           |||| ||||||||||||||| ||||||||||||||||||||| ||||   || |  ||| 
Sbjct: 317 tgttcggaagacttaaagcctggtgatcatattgagatccaaggcaaaaaaaagagtgac 376

                                                         
Query: 139 actcattatgattggtggtatgctgttattggtcacttggactcat 184
            |||||||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 377 cctcattatgaatggttttatgctgttattggtcacttggactcat 422


>gnl|LJGI|GO024643 weakly similar to UniRef100_Q2HSX6 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (49%)
          Length = 631

 Score = 56.0 bits (28), Expect = 8e-08
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 157 tatgctgttattggtcacttggactcat 184
           ||||||||||||||||||||||||||||
Sbjct: 532 tatgctgttattggtcacttggactcat 559