Miyakogusa Predicted Gene

Lj0g3v0148899.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0148899.1 Non Chatacterized Hit- tr|B2W735|B2W735_PYRTR
Putative uncharacterized protein OS=Pyrenophora
tritic,29.85,5.4,seg,NULL,CUFF.9113.1
         (328 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO013033 similar to UniRef100_A8YAX2 Cluster: Genome se...    54   5e-07

>gnl|LJGI|GO013033 similar to UniRef100_A8YAX2 Cluster: Genome sequencing data, contig
           C262; n=1; Microcystis aeruginosa PCC 7806|Rep: Genome
           sequencing data, contig C262 - Microcystis aeruginosa
           PCC 7806, partial (11%)
          Length = 742

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 44/47 (93%), Gaps = 2/47 (4%)
 Strand = Plus / Minus

                                                          
Query: 82  caccgattcatctgcatccttacaaaccccaacctttttcttcaccc 128
           ||||||||||||||||| |||||||||||||| | ||||||||||||
Sbjct: 738 caccgattcatctgcat-cttacaaaccccaa-cattttcttcaccc 694