Miyakogusa Predicted Gene

Lj0g3v0148359.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0148359.1 Non Chatacterized Hit- tr|B9RWA4|B9RWA4_RICCO
Putative uncharacterized protein OS=Ricinus communis
G,33.18,3e-18,coiled-coil,NULL; seg,NULL,CUFF.9073.1
         (637 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO039188                                                     151   6e-36

>gnl|LJGI|GO039188 
          Length = 845

 Score =  151 bits (76), Expect = 6e-36
 Identities = 177/210 (84%), Gaps = 3/210 (1%)
 Strand = Plus / Minus

                                                                       
Query: 420 tgagctgcagcaaacagtggctgcagctagggaattaaaggagaagatgaagggtaaagg 479
           |||| ||||||| |||||| |||||||||| ||||| |||| | | |||||||||||| |
Sbjct: 334 tgagttgcagcagacagtgactgcagctagagaattgaaggtgcacatgaagggtaaaag 275

                                                                       
Query: 480 ggaaaaagagatgattaaatcttctgttgagggactgaagagaagttgcaggggattgga 539
           |||||| |||||||   ||||| |||||||| || |||||| ||| ||||||||||||||
Sbjct: 274 ggaaaaggagatga---aatctgctgttgagagattgaagaaaagatgcaggggattgga 218

                                                                       
Query: 540 ggatgagcttgattttctagaggggagagtaaaggatttgtataaaggtttgattgatgt 599
           ||||| | ||||  || | ||||| ||||| ||||||||||||| | |||||||||||||
Sbjct: 217 ggatgggattgagattattgagggaagagtgaaggatttgtatagaagtttgattgatgt 158

                                         
Query: 600 tagaatggctttgctgggaattctgtccca 629
           ||| |||||| |  |||||||||| |||||
Sbjct: 157 taggatggctcttttgggaattctttccca 128



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 7   aagtatgtgaacacattgagagtggttacacacttgattgatg 49
           ||||||||| ||||||||||||||||| |||| ||| ||||||
Sbjct: 705 aagtatgtggacacattgagagtggttgcacatttggttgatg 663