Miyakogusa Predicted Gene

Lj0g3v0145749.3
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0145749.3 tr|B9I9J7|B9I9J7_POPTR Predicted protein
(Fragment) OS=Populus trichocarpa GN=POPTRDRAFT_245595
PE=4,24.59,2e-18,PPR,Pentatricopeptide repeat; PPR: pentatricopeptide
repeat domain,Pentatricopeptide repeat; PPR_2,P,CUFF.8879.3
         (1477 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58694 homologue to UniRef100_Q9SHF0 Cluster: T19E23.1...    58   2e-07

>gnl|LJGI|TC58694 homologue to UniRef100_Q9SHF0 Cluster: T19E23.10; n=1; Arabidopsis
           thaliana|Rep: T19E23.10 - Arabidopsis thaliana
           (Mouse-ear cress), partial (5%)
          Length = 777

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 760 aaggtgtttgatgaaatgcgtgagagggggatt 792
           |||||||| ||||||||||||||||||||||||
Sbjct: 584 aaggtgttcgatgaaatgcgtgagagggggatt 616