Miyakogusa Predicted Gene
- Lj0g3v0145749.3
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0145749.3 tr|B9I9J7|B9I9J7_POPTR Predicted protein
(Fragment) OS=Populus trichocarpa GN=POPTRDRAFT_245595
PE=4,24.59,2e-18,PPR,Pentatricopeptide repeat; PPR: pentatricopeptide
repeat domain,Pentatricopeptide repeat; PPR_2,P,CUFF.8879.3
(1477 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC58694 homologue to UniRef100_Q9SHF0 Cluster: T19E23.1... 58 2e-07
>gnl|LJGI|TC58694 homologue to UniRef100_Q9SHF0 Cluster: T19E23.10; n=1; Arabidopsis
thaliana|Rep: T19E23.10 - Arabidopsis thaliana
(Mouse-ear cress), partial (5%)
Length = 777
Score = 58.0 bits (29), Expect = 2e-07
Identities = 32/33 (96%)
Strand = Plus / Plus
Query: 760 aaggtgtttgatgaaatgcgtgagagggggatt 792
|||||||| ||||||||||||||||||||||||
Sbjct: 584 aaggtgttcgatgaaatgcgtgagagggggatt 616