Miyakogusa Predicted Gene
- Lj0g3v0145079.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0145079.1 CUFF.8810.1
(340 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72620 similar to UniRef100_Q9MAW6 Cluster: 60S riboso... 141 3e-33
gnl|LJGI|TC81973 similar to UniRef100_A8JK19 Cluster: Predicted ... 109 1e-23
gnl|LJGI|GO035123 similar to UniRef100_Q016H7 Cluster: 26S prote... 90 1e-17
gnl|LJGI|TC63336 UniRef100_A5Z1P0 Cluster: 60S ribosomal protein... 90 1e-17
gnl|LJGI|TC74522 84 6e-16
gnl|LJGI|DC599732 similar to UniRef100_A3KH07 Cluster: Protocadh... 76 2e-13
gnl|LJGI|TC72694 weakly similar to UniRef100_A7PAK3 Cluster: Chr... 54 6e-07
>gnl|LJGI|TC72620 similar to UniRef100_Q9MAW6 Cluster: 60S ribosomal protein L27a;
n=1; Panax ginseng|Rep: 60S ribosomal protein L27a -
Panax ginseng (Korean ginseng), partial (22%)
Length = 887
Score = 141 bits (71), Expect = 3e-33
Identities = 77/79 (97%)
Strand = Plus / Minus
Query: 119 gttgggtttcagatctggtgcttgtggtggtggttggtcctcccctcttcagatctagag 178
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 389 gttgggtttcaaatctggtgcttgtggtggtggttggtcctcctctcttcagatctagag 330
Query: 179 cttgtggcggcgcgagaga 197
|||||||||||||||||||
Sbjct: 329 cttgtggcggcgcgagaga 311
Score = 139 bits (70), Expect = 1e-32
Identities = 82/86 (95%)
Strand = Plus / Minus
Query: 212 ggtgcttgtggtggtggttggtcctcccctcttcagatctagagcttgtggcggcgcgag 271
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 373 ggtgcttgtggtggtggttggtcctcctctcttcagatctagagcttgtggcggcgcgag 314
Query: 272 agaggagcggcgtattggaactcgtg 297
|||||||| ||| || ||||||||||
Sbjct: 313 agaggagcagcggatcggaactcgtg 288
>gnl|LJGI|TC81973 similar to UniRef100_A8JK19 Cluster: Predicted protein; n=1;
Chlamydomonas reinhardtii|Rep: Predicted protein -
Chlamydomonas reinhardtii, partial (5%)
Length = 379
Score = 109 bits (55), Expect = 1e-23
Identities = 64/67 (95%)
Strand = Plus / Minus
Query: 197 acccaccaccgatccggtgcttgtggtggtggttggtcctcccctcttcagatctagagc 256
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 361 acccaccaccgatatggtgcttgtggtggtgggtggtcctcccctcttcagatctagagc 302
Query: 257 ttgtggc 263
|||||||
Sbjct: 301 ttgtggc 295
Score = 97.6 bits (49), Expect = 4e-20
Identities = 52/53 (98%)
Strand = Plus / Minus
Query: 134 tggtgcttgtggtggtggttggtcctcccctcttcagatctagagcttgtggc 186
|||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 347 tggtgcttgtggtggtgggtggtcctcccctcttcagatctagagcttgtggc 295
>gnl|LJGI|GO035123 similar to UniRef100_Q016H7 Cluster: 26S proteasome regulatory
complex subunit RPN11; n=1; Ostreococcus tauri|Rep:
26S, partial (2%)
Length = 285
Score = 89.7 bits (45), Expect = 1e-17
Identities = 51/53 (96%)
Strand = Plus / Minus
Query: 56 caaaagcaccacctttttcgcttggttcgatctacccgtctgtcggcatggct 108
|||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 108 caaaggcaccacctttttcgcttggttcgatctacccatctgtcggcatggct 56
>gnl|LJGI|TC63336 UniRef100_A5Z1P0 Cluster: 60S ribosomal protein L37a; n=1; Paeonia
suffruticosa|Rep: 60S ribosomal protein L37a - Paeonia
suffruticosa (Tree peony), partial (18%)
Length = 697
Score = 89.7 bits (45), Expect = 1e-17
Identities = 51/53 (96%)
Strand = Plus / Minus
Query: 56 caaaagcaccacctttttcgcttggttcgatctacccgtctgtcggcatggct 108
|||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 56 caaaggcaccacctttttcgcttggttcgatctacccatctgtcggcatggct 4
>gnl|LJGI|TC74522
Length = 468
Score = 83.8 bits (42), Expect = 6e-16
Identities = 60/66 (90%)
Strand = Plus / Minus
Query: 232 gtcctcccctcttcagatctagagcttgtggcggcgcgagagaggagcggcgtattggaa 291
||||||| ||||||||||||| ||||||||||||| ||||| |||||||||| || ||||
Sbjct: 226 gtcctcctctcttcagatctaaagcttgtggcggcccgagaaaggagcggcggatcggaa 167
Query: 292 ctcgtg 297
||||||
Sbjct: 166 ctcgtg 161
Score = 58.0 bits (29), Expect = 4e-08
Identities = 38/41 (92%)
Strand = Plus / Minus
Query: 155 gtcctcccctcttcagatctagagcttgtggcggcgcgaga 195
||||||| ||||||||||||| ||||||||||||| |||||
Sbjct: 226 gtcctcctctcttcagatctaaagcttgtggcggcccgaga 186
>gnl|LJGI|DC599732 similar to UniRef100_A3KH07 Cluster: Protocadherin 15b; n=2; Danio
rerio|Rep: Protocadherin 15b - Danio rerio (Zebrafish),
partial (1%)
Length = 543
Score = 75.8 bits (38), Expect = 2e-13
Identities = 53/58 (91%)
Strand = Plus / Minus
Query: 128 cagatctggtgcttgtggtggtggttggtcctcccctcttcagatctagagcttgtgg 185
|||||||||||||||||| ||||||||||||| |||||| |||||| ||||||||||
Sbjct: 491 cagatctggtgcttgtggcggtggttggtccttccctctgaagatctggagcttgtgg 434
Score = 63.9 bits (32), Expect = 6e-10
Identities = 50/56 (89%)
Strand = Plus / Minus
Query: 207 gatccggtgcttgtggtggtggttggtcctcccctcttcagatctagagcttgtgg 262
|||| ||||||||||| ||||||||||||| |||||| |||||| ||||||||||
Sbjct: 489 gatctggtgcttgtggcggtggttggtccttccctctgaagatctggagcttgtgg 434
>gnl|LJGI|TC72694 weakly similar to UniRef100_A7PAK3 Cluster: Chromosome chr14
scaffold_9, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr14 scaffold_9, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (5%)
Length = 485
Score = 54.0 bits (27), Expect = 6e-07
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 6 ctttgtctccctctcgatctggatctc 32
|||||||||||||||||||||||||||
Sbjct: 257 ctttgtctccctctcgatctggatctc 283