Miyakogusa Predicted Gene

Lj0g3v0145079.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0145079.1 CUFF.8810.1
         (340 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72620 similar to UniRef100_Q9MAW6 Cluster: 60S riboso...   141   3e-33
gnl|LJGI|TC81973 similar to UniRef100_A8JK19 Cluster: Predicted ...   109   1e-23
gnl|LJGI|GO035123 similar to UniRef100_Q016H7 Cluster: 26S prote...    90   1e-17
gnl|LJGI|TC63336 UniRef100_A5Z1P0 Cluster: 60S ribosomal protein...    90   1e-17
gnl|LJGI|TC74522                                                       84   6e-16
gnl|LJGI|DC599732 similar to UniRef100_A3KH07 Cluster: Protocadh...    76   2e-13
gnl|LJGI|TC72694 weakly similar to UniRef100_A7PAK3 Cluster: Chr...    54   6e-07

>gnl|LJGI|TC72620 similar to UniRef100_Q9MAW6 Cluster: 60S ribosomal protein L27a;
           n=1; Panax ginseng|Rep: 60S ribosomal protein L27a -
           Panax ginseng (Korean ginseng), partial (22%)
          Length = 887

 Score =  141 bits (71), Expect = 3e-33
 Identities = 77/79 (97%)
 Strand = Plus / Minus

                                                                       
Query: 119 gttgggtttcagatctggtgcttgtggtggtggttggtcctcccctcttcagatctagag 178
           ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 389 gttgggtttcaaatctggtgcttgtggtggtggttggtcctcctctcttcagatctagag 330

                              
Query: 179 cttgtggcggcgcgagaga 197
           |||||||||||||||||||
Sbjct: 329 cttgtggcggcgcgagaga 311



 Score =  139 bits (70), Expect = 1e-32
 Identities = 82/86 (95%)
 Strand = Plus / Minus

                                                                       
Query: 212 ggtgcttgtggtggtggttggtcctcccctcttcagatctagagcttgtggcggcgcgag 271
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 373 ggtgcttgtggtggtggttggtcctcctctcttcagatctagagcttgtggcggcgcgag 314

                                     
Query: 272 agaggagcggcgtattggaactcgtg 297
           |||||||| ||| || ||||||||||
Sbjct: 313 agaggagcagcggatcggaactcgtg 288


>gnl|LJGI|TC81973 similar to UniRef100_A8JK19 Cluster: Predicted protein; n=1;
           Chlamydomonas reinhardtii|Rep: Predicted protein -
           Chlamydomonas reinhardtii, partial (5%)
          Length = 379

 Score =  109 bits (55), Expect = 1e-23
 Identities = 64/67 (95%)
 Strand = Plus / Minus

                                                                       
Query: 197 acccaccaccgatccggtgcttgtggtggtggttggtcctcccctcttcagatctagagc 256
           |||||||||||||  ||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 361 acccaccaccgatatggtgcttgtggtggtgggtggtcctcccctcttcagatctagagc 302

                  
Query: 257 ttgtggc 263
           |||||||
Sbjct: 301 ttgtggc 295



 Score = 97.6 bits (49), Expect = 4e-20
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 134 tggtgcttgtggtggtggttggtcctcccctcttcagatctagagcttgtggc 186
           |||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 347 tggtgcttgtggtggtgggtggtcctcccctcttcagatctagagcttgtggc 295


>gnl|LJGI|GO035123 similar to UniRef100_Q016H7 Cluster: 26S proteasome regulatory
           complex  subunit RPN11; n=1; Ostreococcus tauri|Rep:
           26S, partial (2%)
          Length = 285

 Score = 89.7 bits (45), Expect = 1e-17
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                
Query: 56  caaaagcaccacctttttcgcttggttcgatctacccgtctgtcggcatggct 108
           |||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 108 caaaggcaccacctttttcgcttggttcgatctacccatctgtcggcatggct 56


>gnl|LJGI|TC63336 UniRef100_A5Z1P0 Cluster: 60S ribosomal protein L37a; n=1; Paeonia
           suffruticosa|Rep: 60S ribosomal protein L37a - Paeonia
           suffruticosa (Tree peony), partial (18%)
          Length = 697

 Score = 89.7 bits (45), Expect = 1e-17
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                
Query: 56  caaaagcaccacctttttcgcttggttcgatctacccgtctgtcggcatggct 108
           |||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 56  caaaggcaccacctttttcgcttggttcgatctacccatctgtcggcatggct 4


>gnl|LJGI|TC74522 
          Length = 468

 Score = 83.8 bits (42), Expect = 6e-16
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                       
Query: 232 gtcctcccctcttcagatctagagcttgtggcggcgcgagagaggagcggcgtattggaa 291
           ||||||| ||||||||||||| ||||||||||||| ||||| |||||||||| || ||||
Sbjct: 226 gtcctcctctcttcagatctaaagcttgtggcggcccgagaaaggagcggcggatcggaa 167

                 
Query: 292 ctcgtg 297
           ||||||
Sbjct: 166 ctcgtg 161



 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 155 gtcctcccctcttcagatctagagcttgtggcggcgcgaga 195
           ||||||| ||||||||||||| ||||||||||||| |||||
Sbjct: 226 gtcctcctctcttcagatctaaagcttgtggcggcccgaga 186


>gnl|LJGI|DC599732 similar to UniRef100_A3KH07 Cluster: Protocadherin 15b; n=2; Danio
           rerio|Rep: Protocadherin 15b - Danio rerio (Zebrafish),
           partial (1%)
          Length = 543

 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 128 cagatctggtgcttgtggtggtggttggtcctcccctcttcagatctagagcttgtgg 185
           |||||||||||||||||| ||||||||||||| ||||||  |||||| ||||||||||
Sbjct: 491 cagatctggtgcttgtggcggtggttggtccttccctctgaagatctggagcttgtgg 434



 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 207 gatccggtgcttgtggtggtggttggtcctcccctcttcagatctagagcttgtgg 262
           |||| ||||||||||| ||||||||||||| ||||||  |||||| ||||||||||
Sbjct: 489 gatctggtgcttgtggcggtggttggtccttccctctgaagatctggagcttgtgg 434


>gnl|LJGI|TC72694 weakly similar to UniRef100_A7PAK3 Cluster: Chromosome chr14
           scaffold_9, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr14 scaffold_9, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (5%)
          Length = 485

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 6   ctttgtctccctctcgatctggatctc 32
           |||||||||||||||||||||||||||
Sbjct: 257 ctttgtctccctctcgatctggatctc 283