Miyakogusa Predicted Gene

Lj0g3v0144769.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0144769.1 Non Chatacterized Hit- tr|I1LPV6|I1LPV6_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,83.33,6e-38,Auxin_inducible,Auxin responsive SAUR protein; FAMILY
NOT NAMED,NULL,gene.g10944.t1.1
         (274 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind...   153   7e-37
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu...   149   1e-35
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind...   119   9e-27
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu...   115   1e-25
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu...   105   1e-22
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu...    88   3e-17
gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-ind...    72   2e-12
gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosom...    54   5e-07
gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome...    54   5e-07

>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
           Glycine max|Rep: Auxin-induced protein 6B - Glycine max
           (Soybean), complete
          Length = 494

 Score =  153 bits (77), Expect = 7e-37
 Identities = 134/153 (87%)
 Strand = Plus / Minus

                                                                       
Query: 79  aagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccatatca 138
           ||||||||||||||||| |||||||||||  ||  |||||||||||| |||||  |||||
Sbjct: 310 aagggctatcttgcagtgtatgttggagaagaacagaagaggtttgtaatccctgtatca 251

                                                                       
Query: 139 tacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttggatat 198
           |||||||  ||||||||||| ||||| ||||||| ||||||||||||  | |||||||||
Sbjct: 250 tacttgaaccaaccttcatttcaagaattgctgagtcaagctgaggacgagtttggatat 191

                                            
Query: 199 gaccatccaatgggtggtctcacaattccttgc 231
           || ||||| |||||||| |||||||||||||||
Sbjct: 190 gatcatcccatgggtggcctcacaattccttgc 158


>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (80%)
          Length = 528

 Score =  149 bits (75), Expect = 1e-35
 Identities = 135/155 (87%)
 Strand = Plus / Plus

                                                                       
Query: 73  gtgccaaagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatcccc 132
           ||||||||||| ||||||||||| ||||||||||| |||| |||| ||||||||||||| 
Sbjct: 164 gtgccaaagggatatcttgcagtgtatgttggagataaaacgaagcggtttgtgatccct 223

                                                                       
Query: 133 atatcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaattt 192
           ||||||||| |||  ||||||||||| ||||| || ||   |||||| || ||| |||||
Sbjct: 224 atatcatacctgaaccaaccttcatttcaagagttactacatcaagccgaagaagaattt 283

                                              
Query: 193 ggatatgaccatccaatgggtggtctcacaattcc 227
           |||||||| |||||||| |||||||||||||||||
Sbjct: 284 ggatatgatcatccaataggtggtctcacaattcc 318


>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
           n=1; Glycine max|Rep: Auxin-induced protein 15A -
           Glycine max (Soybean), partial (90%)
          Length = 494

 Score =  119 bits (60), Expect = 9e-27
 Identities = 132/156 (84%)
 Strand = Plus / Plus

                                                                       
Query: 76  ccaaagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccata 135
           ||||| |||||||||||||| ||||||| ||||||||||||  |||||||||||||||| 
Sbjct: 173 ccaaaaggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatt 232

                                                                       
Query: 136 tcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttgga 195
           |||||| |||  ||||||||||| |||||  |  | |  |||||||| ||| |||  |||
Sbjct: 233 tcatacctgaatcaaccttcatttcaagaactattaagccaagctgaagaaaaatacgga 292

                                               
Query: 196 tatgaccatccaatgggtggtctcacaattccttgc 231
           ||||| |||||| ||||||||||| |||||||||||
Sbjct: 293 tatgatcatccagtgggtggtctcgcaattccttgc 328


>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (88%)
          Length = 764

 Score =  115 bits (58), Expect = 1e-25
 Identities = 188/231 (81%), Gaps = 4/231 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggttttcgtttaccaggtatcagaaaggcatcatttgctgtaaaccaatcctctgca 60
           |||||||||| |||| ||||| ||||||  |||| |||||||| ||||    | ||  ||
Sbjct: 394 atgggttttcatttaacaggtgtcagaagagcattatttgctgcaaactgggcttcgtca 453

                                                                       
Query: 61  aaagctgtggacgtgccaaagggctatcttgcagtttatgttggagagaaaatgaagagg 120
           |||| ||| |||||||||||||| ||| ||||||||||||    ||||||| |||||  |
Sbjct: 454 aaagttgtagacgtgccaaagggatatattgcagtttatg----agagaaactgaagccg 509

                                                                       
Query: 121 tttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgattcaagct 180
           | |||||||||||||||||| ||||  |||||   ||| |||| ||| || | |||||||
Sbjct: 510 tgtgtgatccccatatcatatttgaaccaaccacaatttcaaggcttcctaagtcaagct 569

                                                              
Query: 181 gaggaacaatttggatatgaccatccaatgggtggtctcacaattccttgc 231
           |||||| | ||||||||||||||||  | |||||||||||| |||||||||
Sbjct: 570 gaggaagagtttggatatgaccatcacacgggtggtctcacgattccttgc 620


>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (90%)
          Length = 491

 Score =  105 bits (53), Expect = 1e-22
 Identities = 119/141 (84%)
 Strand = Plus / Plus

                                                                       
Query: 86  atcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccatatcatacttga 145
           |||||||||| |||||||||||  |||||| | |||||||||| ||  ||||||||||||
Sbjct: 188 atcttgcagtctatgttggagatgaaatgaggcggtttgtgattccagtatcatacttga 247

                                                                       
Query: 146 gacaaccttcattccaagacttgctgattcaagctgaggaacaatttggatatgaccatc 205
             |||||||| || ||||| || |||  |||||| || ||| ||||||||||||| ||||
Sbjct: 248 accaaccttcttttcaagagttactgcatcaagcagaagaagaatttggatatgatcatc 307

                                
Query: 206 caatgggtggtctcacaattc 226
           |||  ||||||||||||||||
Sbjct: 308 caacaggtggtctcacaattc 328


>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (91%)
          Length = 523

 Score = 87.7 bits (44), Expect = 3e-17
 Identities = 125/152 (82%)
 Strand = Plus / Plus

                                                                       
Query: 76  ccaaagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccata 135
           ||||| ||| |||||||||| |||||||||||  |||||| | |||| ||||| ||  ||
Sbjct: 177 ccaaaaggccatcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagta 236

                                                                       
Query: 136 tcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttgga 195
           ||||||||||  ||||||||||| ||||| || ||   |||||| || ||| ||||||||
Sbjct: 237 tcatacttgaaccaaccttcatttcaagagttactatatcaagccgaagaagaatttgga 296

                                           
Query: 196 tatgaccatccaatgggtggtctcacaattcc 227
           ||||| |||||||  || ||||||| ||||||
Sbjct: 297 tatgatcatccaacaggcggtctcaaaattcc 328


>gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), complete
          Length = 499

 Score = 71.9 bits (36), Expect = 2e-12
 Identities = 108/132 (81%)
 Strand = Plus / Plus

                                                                       
Query: 76  ccaaagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccata 135
           ||||| ||||| |||||||| ||||||||||| |||||||   |||| ||||| ||| ||
Sbjct: 179 ccaaaaggctaccttgcagtctatgttggagataaaatgagacggttcgtgattcccgta 238

                                                                       
Query: 136 tcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttgga 195
           ||| ||||||  ||||||||| | ||||| || ||   |||||| || ||| | ||||||
Sbjct: 239 tcacacttgaaccaaccttcacttcaagagttactacatcaagcagaagaagagtttgga 298

                       
Query: 196 tatgaccatcca 207
           ||||||||||||
Sbjct: 299 tatgaccatcca 310


>gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosome chr4 scaffold_32,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr4 scaffold_32, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (67%)
          Length = 621

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 205 ccaatgggtggtctcacaattccttgc 231
           |||||||||||||||||||||||||||
Sbjct: 362 ccaatgggtggtctcacaattccttgc 388


>gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome chr3 scaffold_8,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr3 scaffold_8, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (64%)
          Length = 636

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 205 ccaatgggtggtctcacaattccttgc 231
           |||||||||||||||||||||||||||
Sbjct: 325 ccaatgggtggtctcacaattccttgc 351