Miyakogusa Predicted Gene
- Lj0g3v0144769.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0144769.1 Non Chatacterized Hit- tr|I1LPV6|I1LPV6_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,83.33,6e-38,Auxin_inducible,Auxin responsive SAUR protein; FAMILY
NOT NAMED,NULL,gene.g10944.t1.1
(274 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind... 153 7e-37
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu... 149 1e-35
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind... 119 9e-27
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu... 115 1e-25
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu... 105 1e-22
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu... 88 3e-17
gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-ind... 72 2e-12
gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosom... 54 5e-07
gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome... 54 5e-07
>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
Glycine max|Rep: Auxin-induced protein 6B - Glycine max
(Soybean), complete
Length = 494
Score = 153 bits (77), Expect = 7e-37
Identities = 134/153 (87%)
Strand = Plus / Minus
Query: 79 aagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccatatca 138
||||||||||||||||| ||||||||||| || |||||||||||| ||||| |||||
Sbjct: 310 aagggctatcttgcagtgtatgttggagaagaacagaagaggtttgtaatccctgtatca 251
Query: 139 tacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttggatat 198
||||||| ||||||||||| ||||| ||||||| |||||||||||| | |||||||||
Sbjct: 250 tacttgaaccaaccttcatttcaagaattgctgagtcaagctgaggacgagtttggatat 191
Query: 199 gaccatccaatgggtggtctcacaattccttgc 231
|| ||||| |||||||| |||||||||||||||
Sbjct: 190 gatcatcccatgggtggcctcacaattccttgc 158
>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (80%)
Length = 528
Score = 149 bits (75), Expect = 1e-35
Identities = 135/155 (87%)
Strand = Plus / Plus
Query: 73 gtgccaaagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatcccc 132
||||||||||| ||||||||||| ||||||||||| |||| |||| |||||||||||||
Sbjct: 164 gtgccaaagggatatcttgcagtgtatgttggagataaaacgaagcggtttgtgatccct 223
Query: 133 atatcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaattt 192
||||||||| ||| ||||||||||| ||||| || || |||||| || ||| |||||
Sbjct: 224 atatcatacctgaaccaaccttcatttcaagagttactacatcaagccgaagaagaattt 283
Query: 193 ggatatgaccatccaatgggtggtctcacaattcc 227
|||||||| |||||||| |||||||||||||||||
Sbjct: 284 ggatatgatcatccaataggtggtctcacaattcc 318
>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
n=1; Glycine max|Rep: Auxin-induced protein 15A -
Glycine max (Soybean), partial (90%)
Length = 494
Score = 119 bits (60), Expect = 9e-27
Identities = 132/156 (84%)
Strand = Plus / Plus
Query: 76 ccaaagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccata 135
||||| |||||||||||||| ||||||| |||||||||||| ||||||||||||||||
Sbjct: 173 ccaaaaggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatt 232
Query: 136 tcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttgga 195
|||||| ||| ||||||||||| ||||| | | | |||||||| ||| ||| |||
Sbjct: 233 tcatacctgaatcaaccttcatttcaagaactattaagccaagctgaagaaaaatacgga 292
Query: 196 tatgaccatccaatgggtggtctcacaattccttgc 231
||||| |||||| ||||||||||| |||||||||||
Sbjct: 293 tatgatcatccagtgggtggtctcgcaattccttgc 328
>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (88%)
Length = 764
Score = 115 bits (58), Expect = 1e-25
Identities = 188/231 (81%), Gaps = 4/231 (1%)
Strand = Plus / Plus
Query: 1 atgggttttcgtttaccaggtatcagaaaggcatcatttgctgtaaaccaatcctctgca 60
|||||||||| |||| ||||| |||||| |||| |||||||| |||| | || ||
Sbjct: 394 atgggttttcatttaacaggtgtcagaagagcattatttgctgcaaactgggcttcgtca 453
Query: 61 aaagctgtggacgtgccaaagggctatcttgcagtttatgttggagagaaaatgaagagg 120
|||| ||| |||||||||||||| ||| |||||||||||| ||||||| ||||| |
Sbjct: 454 aaagttgtagacgtgccaaagggatatattgcagtttatg----agagaaactgaagccg 509
Query: 121 tttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgattcaagct 180
| |||||||||||||||||| |||| ||||| ||| |||| ||| || | |||||||
Sbjct: 510 tgtgtgatccccatatcatatttgaaccaaccacaatttcaaggcttcctaagtcaagct 569
Query: 181 gaggaacaatttggatatgaccatccaatgggtggtctcacaattccttgc 231
|||||| | |||||||||||||||| | |||||||||||| |||||||||
Sbjct: 570 gaggaagagtttggatatgaccatcacacgggtggtctcacgattccttgc 620
>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (90%)
Length = 491
Score = 105 bits (53), Expect = 1e-22
Identities = 119/141 (84%)
Strand = Plus / Plus
Query: 86 atcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccatatcatacttga 145
|||||||||| ||||||||||| |||||| | |||||||||| || ||||||||||||
Sbjct: 188 atcttgcagtctatgttggagatgaaatgaggcggtttgtgattccagtatcatacttga 247
Query: 146 gacaaccttcattccaagacttgctgattcaagctgaggaacaatttggatatgaccatc 205
|||||||| || ||||| || ||| |||||| || ||| ||||||||||||| ||||
Sbjct: 248 accaaccttcttttcaagagttactgcatcaagcagaagaagaatttggatatgatcatc 307
Query: 206 caatgggtggtctcacaattc 226
||| ||||||||||||||||
Sbjct: 308 caacaggtggtctcacaattc 328
>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (91%)
Length = 523
Score = 87.7 bits (44), Expect = 3e-17
Identities = 125/152 (82%)
Strand = Plus / Plus
Query: 76 ccaaagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccata 135
||||| ||| |||||||||| ||||||||||| |||||| | |||| ||||| || ||
Sbjct: 177 ccaaaaggccatcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagta 236
Query: 136 tcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttgga 195
|||||||||| ||||||||||| ||||| || || |||||| || ||| ||||||||
Sbjct: 237 tcatacttgaaccaaccttcatttcaagagttactatatcaagccgaagaagaatttgga 296
Query: 196 tatgaccatccaatgggtggtctcacaattcc 227
||||| ||||||| || ||||||| ||||||
Sbjct: 297 tatgatcatccaacaggcggtctcaaaattcc 328
>gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), complete
Length = 499
Score = 71.9 bits (36), Expect = 2e-12
Identities = 108/132 (81%)
Strand = Plus / Plus
Query: 76 ccaaagggctatcttgcagtttatgttggagagaaaatgaagaggtttgtgatccccata 135
||||| ||||| |||||||| ||||||||||| ||||||| |||| ||||| ||| ||
Sbjct: 179 ccaaaaggctaccttgcagtctatgttggagataaaatgagacggttcgtgattcccgta 238
Query: 136 tcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttgga 195
||| |||||| ||||||||| | ||||| || || |||||| || ||| | ||||||
Sbjct: 239 tcacacttgaaccaaccttcacttcaagagttactacatcaagcagaagaagagtttgga 298
Query: 196 tatgaccatcca 207
||||||||||||
Sbjct: 299 tatgaccatcca 310
>gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosome chr4 scaffold_32,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr4 scaffold_32, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (67%)
Length = 621
Score = 54.0 bits (27), Expect = 5e-07
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 205 ccaatgggtggtctcacaattccttgc 231
|||||||||||||||||||||||||||
Sbjct: 362 ccaatgggtggtctcacaattccttgc 388
>gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome chr3 scaffold_8,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr3 scaffold_8, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (64%)
Length = 636
Score = 54.0 bits (27), Expect = 5e-07
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 205 ccaatgggtggtctcacaattccttgc 231
|||||||||||||||||||||||||||
Sbjct: 325 ccaatgggtggtctcacaattccttgc 351