Miyakogusa Predicted Gene

Lj0g3v0144479.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0144479.1 Non Chatacterized Hit- tr|I1KXQ4|I1KXQ4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.32363 PE,97.78,2e-19,
,CUFF.8765.1
         (138 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP042103 homologue to UniRef100_Q5BLY3 Cluster: Plastid...   274   1e-73

>gnl|LJGI|BP042103 homologue to UniRef100_Q5BLY3 Cluster: Plastid alpha-amylase; n=1;
           Malus x domestica|Rep: Plastid alpha-amylase - Malus
           domestica (Apple) (Malus sylvestris), partial (12%)
          Length = 515

 Score =  274 bits (138), Expect = 1e-73
 Identities = 138/138 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggatcacaaccaagatgcacaccggcagaggattgttgactggataaatgctactggt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 415 atggatcacaaccaagatgcacaccggcagaggattgttgactggataaatgctactggt 356

                                                                       
Query: 61  ggtactgctggtgcatttgatgttactactaaagggattcttcactctgcattggaaaga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 355 ggtactgctggtgcatttgatgttactactaaagggattcttcactctgcattggaaaga 296

                             
Query: 121 tgcgaatattggcgcttg 138
           ||||||||||||||||||
Sbjct: 295 tgcgaatattggcgcttg 278