Miyakogusa Predicted Gene
- Lj0g3v0141009.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0141009.1 NODE_58325_length_1108_cov_20.775270.path2.1
(417 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC76907 homologue to UniRef100_P15792 Cluster: Protein ... 90 1e-17
gnl|LJGI|TC80418 similar to UniRef100_Q41493 Cluster: Stpk1 prot... 56 2e-07
>gnl|LJGI|TC76907 homologue to UniRef100_P15792 Cluster: Protein kinase PVPK-1; n=1;
Phaseolus vulgaris|Rep: Protein kinase PVPK-1 - Phaseolus
vulgaris (Kidney bean) (French bean), partial (73%)
Length = 2457
Score = 89.7 bits (45), Expect = 1e-17
Identities = 114/137 (83%)
Strand = Plus / Plus
Query: 166 gccaggttttacgcggcggaagtgctggtggcattggagtatctacacatgctaggaatc 225
||||||||||||| ||||||||| || | || |||||||| | |||||||| || |||
Sbjct: 1371 gccaggttttacgtggcggaagttctccttgctttggagtacttgcacatgctcgggatc 1430
Query: 226 atctacagagacctcaagccggagaacgtgttggtgagatcagacggtcacatcatgctc 285
|||||||||||||| || || ||||| |||||||| ||| ||| |||||||| ||||||
Sbjct: 1431 atctacagagacctgaaacctgagaatgtgttggtaagagaagatggtcacataatgctc 1490
Query: 286 tccgatttcgatctctc 302
|| || || ||||||||
Sbjct: 1491 tcagactttgatctctc 1507
>gnl|LJGI|TC80418 similar to UniRef100_Q41493 Cluster: Stpk1 protein kinase; n=1;
Solanum tuberosum|Rep: Stpk1 protein kinase - Solanum
tuberosum (Potato), partial (31%)
Length = 595
Score = 56.0 bits (28), Expect = 2e-07
Identities = 85/104 (81%)
Strand = Plus / Plus
Query: 199 ttggagtatctacacatgctaggaatcatctacagagacctcaagccggagaacgtgttg 258
||||||||| | ||||||| || ||||||||||||||||| || || || || || |||
Sbjct: 335 ttggagtatttgcacatgcctgggatcatctacagagaccttaaacccgaaaatgtattg 394
Query: 259 gtgagatcagacggtcacatcatgctctccgatttcgatctctc 302
|||| | ||| ||||| || |||||||| ||||| ||||||||
Sbjct: 395 gtgacaaaagatggtcatataatgctctcagattttgatctctc 438