Miyakogusa Predicted Gene
- Lj0g3v0140239.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0140239.1 tr|G7IL56|G7IL56_MEDTR Auxin response factor
OS=Medicago truncatula GN=MTR_2g005240 PE=4 SV=1,91.38,0,FAMILY NOT
NAMED,NULL; no description,DNA-binding pseudobarrel domain;
DNA-binding pseudobarrel doma,CUFF.8547.1
(1848 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59367 homologue to UniRef100_A4PSF1 Cluster: AUX/IAA ... 765 0.0
gnl|LJGI|BW626159 similar to UniRef100_A5KAE1 Cluster: DnaJ doma... 68 2e-10
gnl|LJGI|TC67005 68 2e-10
>gnl|LJGI|TC59367 homologue to UniRef100_A4PSF1 Cluster: AUX/IAA protein;
Transcriptional factor B3; Auxin response factor; n=1;
Medicago truncatula|Rep: AUX/IAA protein;
Transcriptional factor B3; Auxin response factor -
Medicago truncatula (Barrel medic), partial (26%)
Length = 836
Score = 765 bits (386), Expect = 0.0
Identities = 386/386 (100%)
Strand = Plus / Plus
Query: 1 atgaatcagggattagagcatcaaatgccttcctttaatctgccttgtaaaatattatgt 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 451 atgaatcagggattagagcatcaaatgccttcctttaatctgccttgtaaaatattatgt 510
Query: 61 aaagtggtcaatattcatcttcgggctgagcctgaaacagacgaagtatatgctcagata 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 511 aaagtggtcaatattcatcttcgggctgagcctgaaacagacgaagtatatgctcagata 570
Query: 121 actttgcttcctgaaacagatcaaagtgaggtggcaagcccagacgagcctctgcctgaa 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 571 actttgcttcctgaaacagatcaaagtgaggtggcaagcccagacgagcctctgcctgaa 630
Query: 181 cctacaaggtgtacagtccattcattttgcaagacacttactgcttctgacactagcact 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 631 cctacaaggtgtacagtccattcattttgcaagacacttactgcttctgacactagcact 690
Query: 241 cacggaggtttctctgttcttcgaagacacgcggatgattgtctgccaccactggatatg 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 691 cacggaggtttctctgttcttcgaagacacgcggatgattgtctgccaccactggatatg 750
Query: 301 acccagcagccaccatggcaagaattggttgcaactgatttgcatgggaatgaatggcat 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 751 acccagcagccaccatggcaagaattggttgcaactgatttgcatgggaatgaatggcat 810
Query: 361 tttcggcatatttttcgagggcaacc 386
||||||||||||||||||||||||||
Sbjct: 811 tttcggcatatttttcgagggcaacc 836
>gnl|LJGI|BW626159 similar to UniRef100_A5KAE1 Cluster: DnaJ domain containing
protein; n=1; Plasmodium vivax|Rep: DnaJ domain
containing protein, partial (1%)
Length = 485
Score = 67.9 bits (34), Expect = 2e-10
Identities = 52/58 (89%)
Strand = Plus / Plus
Query: 84 ggctgagcctgaaacagacgaagtatatgctcagataactttgcttcctgaaacagat 141
|||||| ||| ||||||| |||||||||| ||||| |||||||||||||||| |||||
Sbjct: 233 ggctgaacctaaaacagatgaagtatatgatcagacaactttgcttcctgaagcagat 290
>gnl|LJGI|TC67005
Length = 1733
Score = 67.9 bits (34), Expect = 2e-10
Identities = 52/58 (89%)
Strand = Plus / Plus
Query: 84 ggctgagcctgaaacagacgaagtatatgctcagataactttgcttcctgaaacagat 141
|||||| ||| ||||||| |||||||||| ||||| |||||||||||||||| |||||
Sbjct: 482 ggctgaacctaaaacagatgaagtatatgatcagacaactttgcttcctgaagcagat 539