Miyakogusa Predicted Gene

Lj0g3v0140239.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0140239.1 tr|G7IL56|G7IL56_MEDTR Auxin response factor
OS=Medicago truncatula GN=MTR_2g005240 PE=4 SV=1,91.38,0,FAMILY NOT
NAMED,NULL; no description,DNA-binding pseudobarrel domain;
DNA-binding pseudobarrel doma,CUFF.8547.1
         (1848 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59367 homologue to UniRef100_A4PSF1 Cluster: AUX/IAA ...   765   0.0  
gnl|LJGI|BW626159 similar to UniRef100_A5KAE1 Cluster: DnaJ doma...    68   2e-10
gnl|LJGI|TC67005                                                       68   2e-10

>gnl|LJGI|TC59367 homologue to UniRef100_A4PSF1 Cluster: AUX/IAA protein;
           Transcriptional factor B3; Auxin response factor; n=1;
           Medicago truncatula|Rep: AUX/IAA protein;
           Transcriptional factor B3; Auxin response factor -
           Medicago truncatula (Barrel medic), partial (26%)
          Length = 836

 Score =  765 bits (386), Expect = 0.0
 Identities = 386/386 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaatcagggattagagcatcaaatgccttcctttaatctgccttgtaaaatattatgt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 451 atgaatcagggattagagcatcaaatgccttcctttaatctgccttgtaaaatattatgt 510

                                                                       
Query: 61  aaagtggtcaatattcatcttcgggctgagcctgaaacagacgaagtatatgctcagata 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 511 aaagtggtcaatattcatcttcgggctgagcctgaaacagacgaagtatatgctcagata 570

                                                                       
Query: 121 actttgcttcctgaaacagatcaaagtgaggtggcaagcccagacgagcctctgcctgaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 571 actttgcttcctgaaacagatcaaagtgaggtggcaagcccagacgagcctctgcctgaa 630

                                                                       
Query: 181 cctacaaggtgtacagtccattcattttgcaagacacttactgcttctgacactagcact 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 631 cctacaaggtgtacagtccattcattttgcaagacacttactgcttctgacactagcact 690

                                                                       
Query: 241 cacggaggtttctctgttcttcgaagacacgcggatgattgtctgccaccactggatatg 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 691 cacggaggtttctctgttcttcgaagacacgcggatgattgtctgccaccactggatatg 750

                                                                       
Query: 301 acccagcagccaccatggcaagaattggttgcaactgatttgcatgggaatgaatggcat 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 751 acccagcagccaccatggcaagaattggttgcaactgatttgcatgggaatgaatggcat 810

                                     
Query: 361 tttcggcatatttttcgagggcaacc 386
           ||||||||||||||||||||||||||
Sbjct: 811 tttcggcatatttttcgagggcaacc 836


>gnl|LJGI|BW626159 similar to UniRef100_A5KAE1 Cluster: DnaJ domain containing
           protein; n=1; Plasmodium vivax|Rep: DnaJ domain
           containing protein, partial (1%)
          Length = 485

 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 84  ggctgagcctgaaacagacgaagtatatgctcagataactttgcttcctgaaacagat 141
           |||||| ||| ||||||| |||||||||| ||||| |||||||||||||||| |||||
Sbjct: 233 ggctgaacctaaaacagatgaagtatatgatcagacaactttgcttcctgaagcagat 290


>gnl|LJGI|TC67005 
          Length = 1733

 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 84  ggctgagcctgaaacagacgaagtatatgctcagataactttgcttcctgaaacagat 141
           |||||| ||| ||||||| |||||||||| ||||| |||||||||||||||| |||||
Sbjct: 482 ggctgaacctaaaacagatgaagtatatgatcagacaactttgcttcctgaagcagat 539