Miyakogusa Predicted Gene

Lj0g3v0129849.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0129849.1 Non Chatacterized Hit- tr|I1JEI1|I1JEI1_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,87.12,0,S-adenosyl-L-methionine-dependent
methyltransferases,NULL; seg,NULL;
S-ADENOSYL-L-METHIONINE:CARBOXY,CUFF.7859.1
         (1071 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP069360 similar to UniRef100_Q9AR07 Cluster: Jasmonate...    60   3e-08

>gnl|LJGI|BP069360 similar to UniRef100_Q9AR07 Cluster: Jasmonate O-methyltransferase;
           n=1; Arabidopsis thaliana|Rep: Jasmonate
           O-methyltransferase - Arabidopsis thaliana (Mouse-ear
           cress), partial (26%)
          Length = 430

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 157 ggcattgctgatttgggttgctcctctggacccaatac 194
           |||||||| || ||||||||||||||||||||||||||
Sbjct: 156 ggcattgcagacttgggttgctcctctggacccaatac 193