Miyakogusa Predicted Gene

Lj0g3v0128809.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0128809.1 Non Chatacterized Hit- tr|I1LT73|I1LT73_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.51975
PE,84.38,0.0000001,no description,NULL,CUFF.7771.1
         (134 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS321731 similar to UniRef100_Q9ZPD6 Cluster: BnMAP4K a...   264   1e-70
gnl|LJGI|FS343547 similar to UniRef100_Q9ZPD6 Cluster: BnMAP4K a...    76   6e-14

>gnl|LJGI|FS321731 similar to UniRef100_Q9ZPD6 Cluster: BnMAP4K alpha2; n=1; Brassica
           napus|Rep: BnMAP4K alpha2 - Brassica napus (Rape),
           partial (26%)
          Length = 707

 Score =  264 bits (133), Expect = 1e-70
 Identities = 133/133 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtatgaggctggccctgacgaattgcttctgagaatggatgatgtagcgggtctatcg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 138 atgtatgaggctggccctgacgaattgcttctgagaatggatgatgtagcgggtctatcg 197

                                                                       
Query: 61  gaggcagcaggttcgagatttacttcgttggagcttattgggcagggatccttcggtgac 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198 gaggcagcaggttcgagatttacttcgttggagcttattgggcagggatccttcggtgac 257

                        
Query: 121 gtctataaagggt 133
           |||||||||||||
Sbjct: 258 gtctataaagggt 270


>gnl|LJGI|FS343547 similar to UniRef100_Q9ZPD6 Cluster: BnMAP4K alpha2; n=1; Brassica
           napus|Rep: BnMAP4K alpha2 - Brassica napus (Rape),
           partial (25%)
          Length = 760

 Score = 75.8 bits (38), Expect = 6e-14
 Identities = 95/114 (83%)
 Strand = Plus / Plus

                                                                       
Query: 17  ctgacgaattgcttctgagaatggatgatgtagcgggtctatcggaggcagcaggttcga 76
           ||||| ||||||| |||||||||| ||||||||| |||||  | ||||| || || || |
Sbjct: 242 ctgacaaattgctcctgagaatggctgatgtagcaggtcttgctgaggctgctgggtcaa 301

                                                                 
Query: 77  gatttacttcgttggagcttattgggcagggatccttcggtgacgtctataaag 130
           | |||| ||| |||||||| ||||| |||||||| || || |||||||||||||
Sbjct: 302 ggtttagttcattggagctcattggacagggatcatttggcgacgtctataaag 355