Miyakogusa Predicted Gene

Lj0g3v0128059.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0128059.1 Non Chatacterized Hit- tr|I1JKU9|I1JKU9_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,65.24,0,UDPGT,UDP-glucuronosyl/UDP-glucosyltransferase; no
description,NULL; UDP-Glycosyltransferase/glycoge,CUFF.7721.1
         (1465 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP040898 similar to UniRef100_Q8LEG2 Cluster: UTP-gluco...   511   e-144
gnl|LJGI|TC62435 similar to UniRef100_Q8S3B8 Cluster: Zeatin O-g...    54   3e-06

>gnl|LJGI|BP040898 similar to UniRef100_Q8LEG2 Cluster: UTP-glucose glucosyltransferase;
            n=1; Arabidopsis thaliana|Rep: UTP-glucose
            glucosyltransferase - Arabidopsis thaliana (Mouse-ear
            cress), partial (5%)
          Length = 483

 Score =  511 bits (258), Expect = e-144
 Identities = 276/282 (97%)
 Strand = Plus / Minus

                                                                        
Query: 1184 ttggatggccgctctatgcggagcaagggatgaacgctgcaatgctggctgaggaaattg 1243
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 483  ttggatggccgctctatgcggagcaagggatgaacgctgccatgctggctgaggaaattg 424

                                                                        
Query: 1244 gcatcgcggttcgattggagttgccactttctaccaatgtggttggaagggaggagctgg 1303
            ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 423  gcatcgcggttcgattggagttgccactttctacccatgtggttggaagggaggatctgg 364

                                                                        
Query: 1304 caaaagcaataaggaaagttatggataaagaggacgaagaagggtgtgaaatgaggaaaa 1363
            | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 363  ccaaagccataaggaaagttatggataaagaggacgaagaagggtgtgaaatgaggaaaa 304

                                                                        
Query: 1364 aagttaaggagctcaaggaggcagcaaagagggcttggtctgaagatggttcatcctatc 1423
            ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 303  aagttaaggagctcaaggaggcagccaagagggcttggtctgaagatggttcatcctatc 244

                                                      
Query: 1424 ttgcactttcaagaatcagtcaggcaaatggtgcgttatgaa 1465
            ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243  ttgcactttcaagaatcagtcaggcaaatggtgcgttatgaa 202


>gnl|LJGI|TC62435 similar to UniRef100_Q8S3B8 Cluster: Zeatin O-glucosyltransferase;
            n=1; Glycine max|Rep: Zeatin O-glucosyltransferase -
            Glycine max (Soybean), partial (32%)
          Length = 753

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1074 agattgggcaccgcaattggatattctgaagcacccgtctgttggtgggtttgtgagtca 1133
            |||||||||||| |||||||| |||||||| ||||| ||    || |||||  |||||||
Sbjct: 122  agattgggcaccccaattggagattctgaaccacccttcaacaggagggttcatgagtca 181

                           
Query: 1134 ctgtggatggaactc 1148
            |||||| ||||||||
Sbjct: 182  ctgtgggtggaactc 196