Miyakogusa Predicted Gene

Lj0g3v0127889.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0127889.1 Non Chatacterized Hit- tr|C4RI12|C4RI12_9ACTO
Putative uncharacterized protein OS=Micromonospora sp.,39.29,5.8,
,CUFF.7696.1
         (195 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO005675                                                      58   2e-08

>gnl|LJGI|GO005675 
          Length = 537

 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 57  gaggagggggcgatggatgatggaggagacagt 89
           |||||||||||||||||||||| ||||||||||
Sbjct: 132 gaggagggggcgatggatgatgaaggagacagt 100