Miyakogusa Predicted Gene
- Lj0g3v0127459.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0127459.1 Non Chatacterized Hit- tr|I3T6K8|I3T6K8_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,99,0,AP2,AP2/ERF
domain; DNA-binding domain in plant proteins such as,AP2/ERF domain;
AP2_ERF,AP2/ERF dom,NODE_36744_length_986_cov_138.061859.path1.1
(603 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72635 similar to UniRef100_Q75UJ5 Cluster: ERF-like p... 1187 0.0
gnl|LJGI|TC64756 similar to UniRef100_Q9FR33 Cluster: Ripening r... 64 1e-09
gnl|LJGI|TC57892 similar to UniRef100_Q6Q4I4 Cluster: Ethylene r... 64 1e-09
gnl|LJGI|BW616518 UniRef100_P93392 Cluster: S25-XP1 DNA binding ... 54 1e-06
>gnl|LJGI|TC72635 similar to UniRef100_Q75UJ5 Cluster: ERF-like protein; n=1; Cucumis
melo|Rep: ERF-like protein - Cucumis melo (Muskmelon),
partial (49%)
Length = 1042
Score = 1187 bits (599), Expect = 0.0
Identities = 602/603 (99%)
Strand = Plus / Plus
Query: 1 atgacaacatcagaagaaatttatagtttaaaatttttgagccagcatctcttaggggat 60
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 33 atgacaacatcagaagaaatttatagtttaaaatttttgagccagcatctctcaggggat 92
Query: 61 atttcagactcttacctcaccaatctcattcctgtgaaacttgaagactcatcatcagaa 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 93 atttcagactcttacctcaccaatctcattcctgtgaaacttgaagactcatcatcagaa 152
Query: 121 tttgacttggattcacttttctcagaacagagcagcttctgcacttttcttgaaagcttt 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 153 tttgacttggattcacttttctcagaacagagcagcttctgcacttttcttgaaagcttt 212
Query: 181 agcttccaagcagatacagaagttgccatgtctcatgaggcaaagaattcaattacaccg 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 213 agcttccaagcagatacagaagttgccatgtctcatgaggcaaagaattcaattacaccg 272
Query: 241 actcattcaggggaaacccagaagtccagttcacctgaaccagaggtttcagggaaacag 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 273 actcattcaggggaaacccagaagtccagttcacctgaaccagaggtttcagggaaacag 332
Query: 301 gagcaaacttgttatcagggaaggcgttacaggggagtgaggagaaggccatggggtaag 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 333 gagcaaacttgttatcagggaaggcgttacaggggagtgaggagaaggccatggggtaag 392
Query: 361 tttgctgcagagattcgtgacccaacaaggaaagggactagagtgtggcttggaacattt 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 393 tttgctgcagagattcgtgacccaacaaggaaagggactagagtgtggcttggaacattt 452
Query: 421 gacactgagattgatgctgcaaaggcttatgattatgctgctttcaggatgaggggtcgg 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 453 gacactgagattgatgctgcaaaggcttatgattatgctgctttcaggatgaggggtcgg 512
Query: 481 aaagccatattgaatttccctttggaggctgggaaggctagcccaaagcctagcaatagt 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 513 aaagccatattgaatttccctttggaggctgggaaggctagcccaaagcctagcaatagt 572
Query: 541 ggaaggaaaagggggagagaacagagagagtctggtacaagttcaagtcatgttatgtca 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 573 ggaaggaaaagggggagagaacagagagagtctggtacaagttcaagtcatgttatgtca 632
Query: 601 tga 603
|||
Sbjct: 633 tga 635
>gnl|LJGI|TC64756 similar to UniRef100_Q9FR33 Cluster: Ripening regulated protein
DDTFR10/A; n=1; Solanum lycopersicum|Rep: Ripening
regulated protein DDTFR10/A - Solanum lycopersicum
(Tomato) (Lycopersicon esculentum), partial (38%)
Length = 767
Score = 63.9 bits (32), Expect = 1e-09
Identities = 86/104 (82%)
Strand = Plus / Plus
Query: 349 ccatggggtaagtttgctgcagagattcgtgacccaacaaggaaagggactagagtgtgg 408
|||||||| || ||||| ||||||||||||||||| | || |||||| | || ||||||
Sbjct: 526 ccatgggggaaatttgcagcagagattcgtgaccccaatagaaaagggtcaagggtgtgg 585
Query: 409 cttggaacatttgacactgagattgatgctgcaaaggcttatga 452
||||| || |||||||| | ||||| ||||| || ||||||||
Sbjct: 586 cttgggacttttgacacagccattgaagctgctaaagcttatga 629
>gnl|LJGI|TC57892 similar to UniRef100_Q6Q4I4 Cluster: Ethylene response factor 5;
n=1; Solanum lycopersicum|Rep: Ethylene response factor
5 - Solanum lycopersicum (Tomato) (Lycopersicon
esculentum), partial (38%)
Length = 1238
Score = 63.9 bits (32), Expect = 1e-09
Identities = 86/104 (82%)
Strand = Plus / Plus
Query: 349 ccatggggtaagtttgctgcagagattcgtgacccaacaaggaaagggactagagtgtgg 408
|||||||| || ||||| ||||||||||||||||| | || |||||| | || ||||||
Sbjct: 432 ccatgggggaaatttgcagcagagattcgtgaccccaatagaaaagggtcaagggtgtgg 491
Query: 409 cttggaacatttgacactgagattgatgctgcaaaggcttatga 452
||||| || |||||||| | ||||| ||||| || ||||||||
Sbjct: 492 cttgggacttttgacacagccattgaagctgctaaagcttatga 535
>gnl|LJGI|BW616518 UniRef100_P93392 Cluster: S25-XP1 DNA binding protein; n=1;
Nicotiana tabacum|Rep: S25-XP1 DNA binding protein -
Nicotiana tabacum (Common tobacco), partial (10%)
Length = 477
Score = 54.0 bits (27), Expect = 1e-06
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 330 caggggagtgaggagaaggccatgggg 356
|||||||||||||||||||||||||||
Sbjct: 395 caggggagtgaggagaaggccatgggg 421