Miyakogusa Predicted Gene

Lj0g3v0126969.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0126969.1 tr|G7KK50|G7KK50_MEDTR Alanyl-tRNA synthetase
(Fragment) OS=Medicago truncatula GN=MTR_6g045600
PE=3,94.85,0,tRNA-synt_2c,Alanyl-tRNA synthetase, class IIc,
N-terminal; SUBFAMILY NOT NAMED,Alanine-tRNA ligase,,CUFF.7668.1
         (294 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79511 similar to UniRef100_P36428 Cluster: Alanyl-tRN...   224   2e-58

>gnl|LJGI|TC79511 similar to UniRef100_P36428 Cluster: Alanyl-tRNA synthetase,
            mitochondrial precursor; n=2; Arabidopsis thaliana|Rep:
            Alanyl-tRNA synthetase, mitochondrial precursor -
            Arabidopsis thaliana (Mouse-ear cress), partial (28%)
          Length = 1395

 Score =  224 bits (113), Expect = 2e-58
 Identities = 125/129 (96%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgggttttgaacgattgacctctatactacagaacaaaatgagcaattatgacaccgac 60
            |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 887  atgggttttgaacgattgacctctatactacagaaccaaatgagccattatgacaccgac 946

                                                                        
Query: 61   gtctttttgcccatctttgatgctattcagctggcaactggtgctcggccatattctggg 120
            ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 947  gtcttcttgcctatctttgatgctattcagctggcaactggtgctcggccatattctggg 1006

                     
Query: 121  aaagttgga 129
            |||||||||
Sbjct: 1007 aaagttgga 1015