Miyakogusa Predicted Gene

Lj0g3v0125959.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0125959.1 Non Chatacterized Hit- tr|D0NPG4|D0NPG4_PHYIT
Pyridoxal phosphate phosphatase, putative
OS=Phytophth,30.69,2e-17,DKMTPPase-SF:
2,3-diketo-5-methylthio-1-phosphopen,Pyridoxal phosphate
phosphatase-related; HAD-SF-I,CUFF.7558.1
         (720 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC596861 weakly similar to UniRef100_A1ARP5 Cluster: Ca...    60   2e-08

>gnl|LJGI|DC596861 weakly similar to UniRef100_A1ARP5 Cluster: Carboxyl-terminal
           protease precursor; n=1; Pelobacter propionicus DSM
           2379|Rep: Carboxyl-terminal protease precursor -
           Pelobacter propionicus (strain DSM 2379), partial (7%)
          Length = 571

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 30/30 (100%)
 Strand = Plus / Plus

                                         
Query: 144 cagaatgatggaggagcttcactcgcaagg 173
           ||||||||||||||||||||||||||||||
Sbjct: 221 cagaatgatggaggagcttcactcgcaagg 250