Miyakogusa Predicted Gene

Lj0g3v0125499.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0125499.1 Non Chatacterized Hit- tr|I3SB85|I3SB85_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,64.58,0.00000001,
,CUFF.7525.1
         (309 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP056239 weakly similar to UniRef100_A8VPW1 Cluster: Gl...   159   1e-38
gnl|LJGI|GO011581 similar to UniRef100_Q06FE1 Cluster: Glutathio...   107   4e-23
gnl|LJGI|GO009566 similar to UniRef100_Q06FE1 Cluster: Glutathio...   107   4e-23
gnl|LJGI|TC63101 similar to UniRef100_Q9FQD6 Cluster: Glutathion...   107   4e-23
gnl|LJGI|BP046928 similar to UniRef100_Q7TMR7 Cluster: Monocarbo...    68   3e-11
gnl|LJGI|TC61337 similar to UniRef100_A7P767 Cluster: Chromosome...    66   1e-10
gnl|LJGI|TC58493 similar to UniRef100_Q9FQD6 Cluster: Glutathion...    64   5e-10

>gnl|LJGI|BP056239 weakly similar to UniRef100_A8VPW1 Cluster: Glutathione
           S-transferase 5; n=1; Vitis vinifera|Rep: Glutathione
           S-transferase 5 - Vitis vinifera (Grape), partial (18%)
          Length = 494

 Score =  159 bits (80), Expect = 1e-38
 Identities = 110/120 (91%)
 Strand = Plus / Minus

                                                                       
Query: 89  cctatgctgctccaagagatgcggttacgtgtcagattgagaaggaaattgagtttgaag 148
           ||||||||||||| ||||||| ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 326 cctatgctgctcccagagatgtggttatgtgtatgattgagaaggaaattgagtttgaag 267

                                                                       
Query: 149 cagggcatgttgacctctccaaaagggagcataagggacctgagttcttcaagatttcag 208
           | | |||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||
Sbjct: 266 ccgtgcatgttgacctctcccaaagggagcataagggacctgagttcctcaaggtttcag 207


>gnl|LJGI|GO011581 similar to UniRef100_Q06FE1 Cluster: Glutathione S-transferase;
           n=1; Pyrus communis|Rep: Glutathione S-transferase -
           Pyrus communis (Pear), partial (86%)
          Length = 725

 Score =  107 bits (54), Expect = 4e-23
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 71  tgaaggtatgtggtcccacctatgctgctccaagagatgcggttacgtgtcagattgaga 130
           ||||||| | ||||||||||||||||||||||| ||  | ||||| ||||| ||||||||
Sbjct: 138 tgaaggtgtatggtcccacctatgctgctccaaaaggggtggttatgtgtctgattgaga 197

                                                                       
Query: 131 aggaaattgagtttgaagcagggcatgttgacctctccaaaagggagcataagggacctg 190
           | ||||||||||||||| ||| ||  ||||||||||||||| ||||  | |||  |||||
Sbjct: 198 aagaaattgagtttgaatcagtgcccgttgacctctccaaaggggaaaacaagacacctg 257

                         
Query: 191 agttcttcaagatt 204
           ||||| ||||||||
Sbjct: 258 agttcctcaagatt 271


>gnl|LJGI|GO009566 similar to UniRef100_Q06FE1 Cluster: Glutathione S-transferase;
           n=1; Pyrus communis|Rep: Glutathione S-transferase -
           Pyrus communis (Pear), partial (51%)
          Length = 650

 Score =  107 bits (54), Expect = 4e-23
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 71  tgaaggtatgtggtcccacctatgctgctccaagagatgcggttacgtgtcagattgaga 130
           ||||||| | ||||||||||||||||||||||| ||  | ||||| ||||| ||||||||
Sbjct: 53  tgaaggtgtatggtcccacctatgctgctccaaaaggggtggttatgtgtctgattgaga 112

                                                                       
Query: 131 aggaaattgagtttgaagcagggcatgttgacctctccaaaagggagcataagggacctg 190
           | ||||||||||||||| ||| ||  ||||||||||||||| ||||  | |||  |||||
Sbjct: 113 aagaaattgagtttgaatcagtgcccgttgacctctccaaaggggaaaacaagacacctg 172

                         
Query: 191 agttcttcaagatt 204
           ||||| ||||||||
Sbjct: 173 agttcctcaagatt 186


>gnl|LJGI|TC63101 similar to UniRef100_Q9FQD6 Cluster: Glutathione S-transferase GST
           22; n=1; Glycine max|Rep: Glutathione S-transferase GST
           22 - Glycine max (Soybean), complete
          Length = 955

 Score =  107 bits (54), Expect = 4e-23
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 71  tgaaggtatgtggtcccacctatgctgctccaagagatgcggttacgtgtcagattgaga 130
           ||||||| | ||||||||||||||||||||||| ||  | ||||| ||||| ||||||||
Sbjct: 140 tgaaggtgtatggtcccacctatgctgctccaaaaggggtggttatgtgtctgattgaga 199

                                                                       
Query: 131 aggaaattgagtttgaagcagggcatgttgacctctccaaaagggagcataagggacctg 190
           | ||||||||||||||| ||| ||  ||||||||||||||| ||||  | |||  |||||
Sbjct: 200 aagaaattgagtttgaatcagtgcccgttgacctctccaaaggggaaaacaagacacctg 259

                         
Query: 191 agttcttcaagatt 204
           ||||| ||||||||
Sbjct: 260 agttcctcaagatt 273


>gnl|LJGI|BP046928 similar to UniRef100_Q7TMR7 Cluster: Monocarboxylate transporter 7B
           splice variant; n=2; Rattus norvegicus|Rep:
           Monocarboxylate, partial (3%)
          Length = 280

 Score = 67.9 bits (34), Expect = 3e-11
 Identities = 71/83 (85%), Gaps = 4/83 (4%)
 Strand = Plus / Minus

                                                                       
Query: 185 gacctgagttcttcaagatttcaggttcaatttttcacttcttttttgttgaaaaagttc 244
           ||||||||||| || ||||||||||||| | ||||||||| ||||||     ||||||||
Sbjct: 244 gacctgagttcctccagatttcaggttccaattttcactttttttttt----aaaagttc 189

                                  
Query: 245 attttaatattatacttgatcac 267
           |||||||| |||||||| |||||
Sbjct: 188 attttaatcttatactttatcac 166


>gnl|LJGI|TC61337 similar to UniRef100_A7P767 Cluster: Chromosome chr9 scaffold_7,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr9 scaffold_7, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (18%)
          Length = 784

 Score = 65.9 bits (33), Expect = 1e-10
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 10  cgttggttaaagcattgcagctcatgctatcctttctcttttggt 54
           ||||| |||||||||||||||||||||||||||| ||||| ||||
Sbjct: 212 cgttgattaaagcattgcagctcatgctatccttcctcttctggt 256


>gnl|LJGI|TC58493 similar to UniRef100_Q9FQD6 Cluster: Glutathione S-transferase GST
           22; n=1; Glycine max|Rep: Glutathione S-transferase GST
           22 - Glycine max (Soybean), complete
          Length = 959

 Score = 63.9 bits (32), Expect = 5e-10
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 117 gtgtcagattgagaaggaaattgagtttgaagcagggcatgttgacctctccaaaaggga 176
           ||||| ||||||||||||||||||||||||| ||| || ||||||  ||| ||| || ||
Sbjct: 105 gtgtctgattgagaaggaaattgagtttgaaacagtgcctgttgatatcttcaagagaga 164

                   
Query: 177 gcataagg 184
           ||||||||
Sbjct: 165 gcataagg 172