Miyakogusa Predicted Gene
- Lj0g3v0124439.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0124439.1 tr|G7ZY41|G7ZY41_MEDTR Vascular protein
OS=Medicago truncatula GN=MTR_066s1023 PE=4 SV=1,88.14,0,
,NODE_23204_length_1104_cov_134.116852.path2.1
(759 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AV406527 similar to UniRef100_UPI0000196FB7 Cluster: tr... 133 2e-30
>gnl|LJGI|AV406527 similar to UniRef100_UPI0000196FB7 Cluster: transducin family
protein / WD-40 repeat family protein; n=1; Arabidopsis
thaliana|Rep: transducin family protein / WD-40 repeat
family protein - Arabidopsis thaliana, partial (8%)
Length = 442
Score = 133 bits (67), Expect = 2e-30
Identities = 73/75 (97%)
Strand = Plus / Plus
Query: 685 aagctcatacaagggtaccgcttatcgacttcaactgccaatggccattatatctcaacc 744
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1 aagctcatacaagggtaccgcttatcgacttcaactgccaatggccattataggtcaacc 60
Query: 745 aacagtgagggaaaa 759
|||||||||||||||
Sbjct: 61 aacagtgagggaaaa 75