Miyakogusa Predicted Gene

Lj0g3v0120749.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0120749.1 tr|Q04XT5|Q04XT5_LEPBL Serine/threonine kinase
with GAF domain OS=Leptospira borgpetersenii serovar ,32.35,4.4,
,CUFF.7184.1
         (229 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO005302 similar to UniRef100_Q485A6 Cluster: Methyl-ac...    90   7e-18

>gnl|LJGI|GO005302 similar to UniRef100_Q485A6 Cluster: Methyl-accepting chemotaxis
           protein; n=1; Colwellia psychrerythraea 34H|Rep:,
           partial (3%)
          Length = 699

 Score = 89.7 bits (45), Expect = 7e-18
 Identities = 54/57 (94%)
 Strand = Plus / Minus

                                                                    
Query: 162 ttatgattcattgattgatctcttcagtacaagatgctttatataccatgacttgag 218
           |||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||
Sbjct: 233 ttatgaatcattgattaatctcttcagtacaagatgctttatatacaatgacttgag 177