Miyakogusa Predicted Gene
- Lj0g3v0115859.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0115859.1 Non Chatacterized Hit- tr|I3T814|I3T814_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,85.71,0.00000002,
,CUFF.6784.1
(153 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BW610568 similar to UniRef100_A5AWM5 Cluster: DNA topoi... 254 1e-67
gnl|LJGI|TC74258 98 2e-20
gnl|LJGI|TC75726 similar to UniRef100_P15646 Cluster: rRNA 2'-O-... 68 2e-11
gnl|LJGI|FS326156 60 4e-09
gnl|LJGI|FS321501 54 2e-07
>gnl|LJGI|BW610568 similar to UniRef100_A5AWM5 Cluster: DNA topoisomerase; n=1; Vitis
vinifera|Rep: DNA topoisomerase - Vitis vinifera
(Grape), partial (3%)
Length = 458
Score = 254 bits (128), Expect = 1e-67
Identities = 137/140 (97%)
Strand = Plus / Plus
Query: 14 ttcatgcagatcatgcttctgcaattcctatgccagttccggttgctgttgctcaatcac 73
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 109 ttcatgcagatcatgcttctgcaattcctatgccagttccggttggtgttgctcaatcac 168
Query: 74 agttgagttcttctacattggttcacaagctcacgctgaagcttgatgactccaattttc 133
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 169 tgttgagttcctctacattggttcacaagctcacgctgaagcttgatgactccaattttc 228
Query: 134 tctcctggaagcaacacgtt 153
||||||||||||||||||||
Sbjct: 229 tctcctggaagcaacacgtt 248
>gnl|LJGI|TC74258
Length = 671
Score = 97.6 bits (49), Expect = 2e-20
Identities = 61/65 (93%)
Strand = Plus / Plus
Query: 85 tctacattggttcacaagctcacgctgaagcttgatgactccaattttctctcctggaag 144
|||||| ||||||||||||||||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 217 tctacactggttcacaagctcacgctgaagcttgatgattccaatttcctctcatggaag 276
Query: 145 caaca 149
|||||
Sbjct: 277 caaca 281
>gnl|LJGI|TC75726 similar to UniRef100_P15646 Cluster: rRNA 2'-O-methyltransferase
fibrillarin; n=2; Saccharomyces cerevisiae|Rep: rRNA
2'-O-methyltransferase fibrillarin - Saccharomyces
cerevisiae (Baker's yeast), partial (7%)
Length = 1145
Score = 67.9 bits (34), Expect = 2e-11
Identities = 55/62 (88%)
Strand = Plus / Plus
Query: 92 tggttcacaagctcacgctgaagcttgatgactccaattttctctcctggaagcaacacg 151
||||||||||||| |||||||||||||| |||||||||||||| |||||||| ||||
Sbjct: 180 tggttcacaagcttgttctgaagcttgatgattccaattttctctcatggaagcagcacg 239
Query: 152 tt 153
||
Sbjct: 240 tt 241
>gnl|LJGI|FS326156
Length = 695
Score = 60.0 bits (30), Expect = 4e-09
Identities = 66/78 (84%)
Strand = Plus / Plus
Query: 75 gttgagttcttctacattggttcacaagctcacgctgaagcttgatgactccaattttct 134
||||||| ||||| | |||||||||||||||| ||||||||||||| | || || ||
Sbjct: 159 gttgagtgcttcttctctggttcacaagctcaccttgaagcttgatgatacgaacttcct 218
Query: 135 ctcctggaagcaacacgt 152
||| ||||||||||||||
Sbjct: 219 ctcatggaagcaacacgt 236
>gnl|LJGI|FS321501
Length = 679
Score = 54.0 bits (27), Expect = 2e-07
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 64 gctcaatcacagttgagttcttctacattggttcacaagctcacgctgaagcttgatgac 123
|||||| | ||||||||||| || || | ||||||||||| ||| |||||||||||||
Sbjct: 169 gctcaaccgcagttgagttcatccacgcttgttcacaagcttacgttgaagcttgatgat 228
Query: 124 tccaattttctctcctggaagca 146
| |||||||| || ||||||||
Sbjct: 229 acaaattttctttcatggaagca 251