Miyakogusa Predicted Gene

Lj0g3v0115859.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0115859.1 Non Chatacterized Hit- tr|I3T814|I3T814_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,85.71,0.00000002,
,CUFF.6784.1
         (153 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW610568 similar to UniRef100_A5AWM5 Cluster: DNA topoi...   254   1e-67
gnl|LJGI|TC74258                                                       98   2e-20
gnl|LJGI|TC75726 similar to UniRef100_P15646 Cluster: rRNA 2'-O-...    68   2e-11
gnl|LJGI|FS326156                                                      60   4e-09
gnl|LJGI|FS321501                                                      54   2e-07

>gnl|LJGI|BW610568 similar to UniRef100_A5AWM5 Cluster: DNA topoisomerase; n=1; Vitis
           vinifera|Rep: DNA topoisomerase - Vitis vinifera
           (Grape), partial (3%)
          Length = 458

 Score =  254 bits (128), Expect = 1e-67
 Identities = 137/140 (97%)
 Strand = Plus / Plus

                                                                       
Query: 14  ttcatgcagatcatgcttctgcaattcctatgccagttccggttgctgttgctcaatcac 73
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 109 ttcatgcagatcatgcttctgcaattcctatgccagttccggttggtgttgctcaatcac 168

                                                                       
Query: 74  agttgagttcttctacattggttcacaagctcacgctgaagcttgatgactccaattttc 133
            ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 169 tgttgagttcctctacattggttcacaagctcacgctgaagcttgatgactccaattttc 228

                               
Query: 134 tctcctggaagcaacacgtt 153
           ||||||||||||||||||||
Sbjct: 229 tctcctggaagcaacacgtt 248


>gnl|LJGI|TC74258 
          Length = 671

 Score = 97.6 bits (49), Expect = 2e-20
 Identities = 61/65 (93%)
 Strand = Plus / Plus

                                                                       
Query: 85  tctacattggttcacaagctcacgctgaagcttgatgactccaattttctctcctggaag 144
           |||||| ||||||||||||||||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 217 tctacactggttcacaagctcacgctgaagcttgatgattccaatttcctctcatggaag 276

                
Query: 145 caaca 149
           |||||
Sbjct: 277 caaca 281


>gnl|LJGI|TC75726 similar to UniRef100_P15646 Cluster: rRNA 2'-O-methyltransferase
           fibrillarin; n=2; Saccharomyces cerevisiae|Rep: rRNA
           2'-O-methyltransferase fibrillarin - Saccharomyces
           cerevisiae (Baker's yeast), partial (7%)
          Length = 1145

 Score = 67.9 bits (34), Expect = 2e-11
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 92  tggttcacaagctcacgctgaagcttgatgactccaattttctctcctggaagcaacacg 151
           |||||||||||||    |||||||||||||| |||||||||||||| |||||||| ||||
Sbjct: 180 tggttcacaagcttgttctgaagcttgatgattccaattttctctcatggaagcagcacg 239

             
Query: 152 tt 153
           ||
Sbjct: 240 tt 241


>gnl|LJGI|FS326156 
          Length = 695

 Score = 60.0 bits (30), Expect = 4e-09
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 75  gttgagttcttctacattggttcacaagctcacgctgaagcttgatgactccaattttct 134
           ||||||| ||||| |  ||||||||||||||||  |||||||||||||  | || || ||
Sbjct: 159 gttgagtgcttcttctctggttcacaagctcaccttgaagcttgatgatacgaacttcct 218

                             
Query: 135 ctcctggaagcaacacgt 152
           ||| ||||||||||||||
Sbjct: 219 ctcatggaagcaacacgt 236


>gnl|LJGI|FS321501 
          Length = 679

 Score = 54.0 bits (27), Expect = 2e-07
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 64  gctcaatcacagttgagttcttctacattggttcacaagctcacgctgaagcttgatgac 123
           |||||| | ||||||||||| || ||  | ||||||||||| ||| ||||||||||||| 
Sbjct: 169 gctcaaccgcagttgagttcatccacgcttgttcacaagcttacgttgaagcttgatgat 228

                                  
Query: 124 tccaattttctctcctggaagca 146
            | |||||||| || ||||||||
Sbjct: 229 acaaattttctttcatggaagca 251