Miyakogusa Predicted Gene

Lj0g3v0115549.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0115549.1 Non Chatacterized Hit- tr|I1KT07|I1KT07_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.1241
PE=,40.71,0.000000000000003,F_box_assoc_1: F-box protein interaction
domain,F-box associated interaction domain,CUFF.6753.1
         (393 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66505 similar to UniRef100_Q2HS67 Cluster: Cyclin-lik...   117   5e-26
gnl|LJGI|TC79393                                                       54   7e-07

>gnl|LJGI|TC66505 similar to UniRef100_Q2HS67 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (17%)
          Length = 1292

 Score =  117 bits (59), Expect = 5e-26
 Identities = 110/127 (86%)
 Strand = Plus / Plus

                                                                       
Query: 167 tgtgcaagacaatggttcattgcattggtgagagttgctggagagagattctgagcatcc 226
           ||||||| |||||| |||||| ||| ||||| | ||| |||||||||||| ||||| |||
Sbjct: 610 tgtgcaaaacaatgcttcattccatcggtgatacttgttggagagagattttgagcgtcc 669

                                                                       
Query: 227 ctgacagcccaattgactttcgtcattccaatggactctttgtaggtggctgcgttaatt 286
           |||||  ||||||||| ||||||||   ||||||||| |||||||||||||| |||||||
Sbjct: 670 ctgacgtcccaattgagtttcgtcaaatcaatggactgtttgtaggtggctgtgttaatt 729

                  
Query: 287 ggttagc 293
           |||||||
Sbjct: 730 ggttagc 736


>gnl|LJGI|TC79393 
          Length = 697

 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 175 acaatggttcattgcattggtgagagttgctggagagagattctgagcatccctgacagc 234
           ||||||||||||||||| ||||| ||||| |||||| |||||  |||   ||||| |  |
Sbjct: 42  acaatggttcattgcatcggtgatagttgttggagacagatttcgagggaccctggcctc 101

                                                                      
Query: 235 ccaattgactttcgtcattccaatggactctttgtaggtggctgcgttaattggttagc 293
           ||| ||||  |   |||| |||||||||| |||||||| ||||| ||||||||| ||||
Sbjct: 102 ccagttgagctagatcataccaatggactgtttgtagggggctgtgttaattgggtagc 160