Miyakogusa Predicted Gene
- Lj0g3v0115459.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0115459.1 Non Chatacterized Hit- tr|G3UBP2|G3UBP2_LOXAF
Uncharacterized protein OS=Loxodonta africana
GN=PCNXL,40.91,9.4,seg,NULL,CUFF.6750.1
(288 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC592957 similar to UniRef100_Q94A39 Cluster: At1g12930... 216 6e-56
>gnl|LJGI|DC592957 similar to UniRef100_Q94A39 Cluster: At1g12930/F13K23_14; n=1;
Arabidopsis thaliana|Rep: At1g12930/F13K23_14 -
Arabidopsis thaliana (Mouse-ear cress), partial (13%)
Length = 523
Score = 216 bits (109), Expect = 6e-56
Identities = 121/125 (96%)
Strand = Plus / Minus
Query: 84 gtttgtggaaactgagggagccactgattggctgcgacgcggttgcacgattgggtatcg 143
|||||| | |||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125 gtttgttggaactgaacgagccactgattggctgcgacgcggttgcacgattgggtatcg 66
Query: 144 tggttcaacacatggacggcctcagctaccttcattgccaattccatctcctctttctca 203
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65 tggttcaacacatggacggcctcagctaccttcattgccaattccatctcctctttctca 6
Query: 204 ctcac 208
|||||
Sbjct: 5 ctcac 1