Miyakogusa Predicted Gene

Lj0g3v0115159.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0115159.1 CUFF.6729.1
         (2643 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72921 homologue to UniRef100_A7P1H0 Cluster: Chromoso...    76   1e-12
gnl|LJGI|TC74542 similar to UniRef100_Q94KF2 Cluster: Pto-like k...    64   5e-09
gnl|LJGI|TC78562 similar to UniRef100_A7U519 Cluster: FERONIA re...    60   7e-08
gnl|LJGI|BP042662 similar to UniRef100_Q94KF2 Cluster: Pto-like ...    54   5e-06

>gnl|LJGI|TC72921 homologue to UniRef100_A7P1H0 Cluster: Chromosome chr19 scaffold_4,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr19 scaffold_4, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (24%)
          Length = 592

 Score = 75.8 bits (38), Expect = 1e-12
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                        
Query: 2025 tcatgtgagcactgcagtgaaaggtagctttggttatcttgaccctgagtacttcaggag 2084
            ||||||||||||||| || ||||| || || |||||||| || |||||||| || || ||
Sbjct: 330  tcatgtgagcactgctgttaaaggcagtttcggttatctcgatcctgagtattttagaag 389

                                                      
Query: 2085 gcagcaattgactgagaaatcagatgtgtactcatttggagt 2126
            ||||||| | || |||||||| ||||| || |||||||||||
Sbjct: 390  gcagcaacttacagagaaatctgatgtttattcatttggagt 431


>gnl|LJGI|TC74542 similar to UniRef100_Q94KF2 Cluster: Pto-like kinase SG5-3e; n=1;
            Phaseolus vulgaris|Rep: Pto-like kinase SG5-3e -
            Phaseolus vulgaris (Kidney bean) (French bean), partial
            (71%)
          Length = 851

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                        
Query: 2327 atggtgttgataggcctccaatgggggatgttctgtggaacttggagtatgcattgcagc 2386
            |||||| |||||||||| |||||||||||||  ||||| |||||||||| ||  ||||||
Sbjct: 433  atggtggtgataggccttcaatgggggatgtgttgtgggacttggagtacgcgctgcagc 492

                
Query: 2387 ttca 2390
            ||||
Sbjct: 493  ttca 496


>gnl|LJGI|TC78562 similar to UniRef100_A7U519 Cluster: FERONIA receptor-like kinase;
            n=1; Arabidopsis lyrata|Rep: FERONIA receptor-like kinase
            - Arabidopsis lyrata (Lyre-leaved rock-cress), partial
            (53%)
          Length = 1878

 Score = 60.0 bits (30), Expect = 7e-08
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 2074 tacttcaggaggcagcaattgactgagaaatcagatgtgtactcatttggagtggtgctg 2133
            |||||||||||||||||| | || || ||||| |||||||||||||| || ||||| |||
Sbjct: 999  tacttcaggaggcagcaactcaccgacaaatctgatgtgtactcattcggtgtggttctg 1058

              
Query: 2134 tt 2135
            ||
Sbjct: 1059 tt 1060


>gnl|LJGI|BP042662 similar to UniRef100_Q94KF2 Cluster: Pto-like kinase SG5-3e; n=1;
            Phaseolus vulgaris|Rep: Pto-like kinase SG5-3e -
            Phaseolus vulgaris (Kidney bean) (French bean), partial
            (39%)
          Length = 484

 Score = 54.0 bits (27), Expect = 5e-06
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 2334 tgataggcctccaatgggggatgttctgtggaacttggagtatgcattgca 2384
            |||||||||| ||||| |||||||  ||||| |||||||||||||| ||||
Sbjct: 165  tgataggcctacaatgcgggatgtgttgtgggacttggagtatgcactgca 115