Miyakogusa Predicted Gene

Lj0g3v0114929.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0114929.1 Non Chatacterized Hit- tr|K4CS14|K4CS14_SOLLC
Uncharacterized protein OS=Solanum lycopersicum GN=Sol,50,0.0000004,
,CUFF.6711.1
         (252 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP066886 homologue to UniRef100_A9KLF4 Cluster: Transcr...    76   1e-13

>gnl|LJGI|BP066886 homologue to UniRef100_A9KLF4 Cluster: Transcriptional regulator,
           XRE family; n=1; Clostridium phytofermentans ISDg|Rep:
           Transcriptional regulator, XRE family - Clostridium
           phytofermentans ISDg, partial (7%)
          Length = 362

 Score = 75.8 bits (38), Expect = 1e-13
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 94  aatggacttgtgagtctttacaaagatatggagtcttgtggagaatatgcagatatccaa 153
           ||||| ||||| | |||||| || ||||||||||||||||| ||||||| |||||| | |
Sbjct: 361 aatgggcttgttaatctttataaggatatggagtcttgtggtgaatatgaagatatacca 302

                             
Query: 154 gtcatgtggaaaatgatt 171
           || |||||||||||||||
Sbjct: 301 gttatgtggaaaatgatt 284