Miyakogusa Predicted Gene

Lj0g3v0114159.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0114159.1 Non Chatacterized Hit- tr|I3T8E0|I3T8E0_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,62.86,0.006,
,CUFF.6642.1
         (228 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65535 weakly similar to UniRef100_Q647J9 Cluster: Hom...   226   4e-59
gnl|LJGI|TC66702 weakly similar to UniRef100_Q58FG4 Cluster: Hom...    88   3e-17
gnl|LJGI|FS339451 weakly similar to UniRef100_Q58FG4 Cluster: Ho...    68   2e-11

>gnl|LJGI|TC65535 weakly similar to UniRef100_Q647J9 Cluster: Homogentisate
           phytylprenyltransferase; n=1; Medicago sativa|Rep:
           Homogentisate phytylprenyltransferase - Medicago sativa
           (Alfalfa), partial (67%)
          Length = 1462

 Score =  226 bits (114), Expect = 4e-59
 Identities = 114/114 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgatgcaatcgtttcttgttggatctttgcctaatgcatcttcattcaccaccggtgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 66  atgatgcaatcgtttcttgttggatctttgcctaatgcatcttcattcaccaccggtgga 125

                                                                 
Query: 61  aatctctggcagagtactaagcatggcgccaataagaataaatactatgaaagt 114
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 126 aatctctggcagagtactaagcatggcgccaataagaataaatactatgaaagt 179


>gnl|LJGI|TC66702 weakly similar to UniRef100_Q58FG4 Cluster: Homogentisate
           phytylprenyltransferase; n=1; Glycine max|Rep:
           Homogentisate phytylprenyltransferase - Glycine max
           (Soybean), partial (90%)
          Length = 1506

 Score = 87.7 bits (44), Expect = 3e-17
 Identities = 97/114 (85%), Gaps = 3/114 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgatgcaatcgtttcttgttggatctttgcctaatgcatcttcattcaccaccggtgga 60
           |||||| | |||||||||||||| ||| | ||||||||||||||||||||||| ||||||
Sbjct: 46  atgatggagtcgtttcttgttggttctcttcctaatgcatcttcattcaccactggtgga 105

                                                                 
Query: 61  aatctctggcagagtactaagcatggcgccaataagaataaatactatgaaagt 114
           ||||||| || |||||   | ||| | |||||||||||||  ||||||| ||||
Sbjct: 106 aatctcttgcggagta---aacatcgtgccaataagaatatttactatgcaagt 156


>gnl|LJGI|FS339451 weakly similar to UniRef100_Q58FG4 Cluster: Homogentisate
           phytylprenyltransferase; n=1; Glycine max|Rep:
           Homogentisate phytylprenyltransferase - Glycine max
           (Soybean), partial (44%)
          Length = 784

 Score = 67.9 bits (34), Expect = 2e-11
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 10  tcgtttcttgttggatctttgcctaatgcatcttcattcaccaccggtggaaatctct 67
           |||| ||||||||||||||| ||| |||| |||||| ||||||| |||||||||||||
Sbjct: 81  tcgtatcttgttggatcttttcctcatgcctcttcaatcaccactggtggaaatctct 138