Miyakogusa Predicted Gene

Lj0g3v0114059.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0114059.1 Non Chatacterized Hit- tr|Q0A9A6|Q0A9A6_ALHEH
Putative membrane protein; K07288 uncharacterized memb,37.04,4.9,
,CUFF.6635.1
         (211 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67133                                                      165   1e-40
gnl|LJGI|TC64037 similar to UniRef100_Q6QNA3 Cluster: Proline-ri...    50   5e-06

>gnl|LJGI|TC67133 
          Length = 801

 Score =  165 bits (83), Expect = 1e-40
 Identities = 89/91 (97%)
 Strand = Plus / Minus

                                                                       
Query: 121 atcgagaccaccacgccttcatctctttcttctgatgttgggtttgctgagggtggggtg 180
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 247 atcgagaccactacaccttcatctctttcttctgatgttgggtttgctgagggtggggtg 188

                                          
Query: 181 ggtttatggattcggtggtggctttgttaaa 211
           |||||||||||||||||||||||||||||||
Sbjct: 187 ggtttatggattcggtggtggctttgttaaa 157



 Score =  141 bits (71), Expect = 2e-33
 Identities = 90/95 (94%), Gaps = 1/95 (1%)
 Strand = Plus / Minus

                                                                       
Query: 4   agcaaagaaaaacccacacctcttacaaaccttgcaagacccagccgtatccgagccaaa 63
           ||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 332 agcaaagaaaaacacagacctcttacaaaccttgcaagacccagccgtacccgagccaaa 273

                                              
Query: 64  gtcaccgtcgcgagtttgagcccaagatcgagacc 98
           ||||| ||||||||||||||||| |||||||||||
Sbjct: 272 gtcactgtcgcgagtttgagccc-agatcgagacc 239


>gnl|LJGI|TC64037 similar to UniRef100_Q6QNA3 Cluster: Proline-rich protein 1; n=1;
           Capsicum annuum|Rep: Proline-rich protein 1 - Capsicum
           annuum (Bell pepper), partial (7%)
          Length = 1084

 Score = 50.1 bits (25), Expect = 5e-06
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 137 cttcatctctttcttctgatgttgggttt 165
           ||||||||||||||||||||||| |||||
Sbjct: 139 cttcatctctttcttctgatgtttggttt 167