Miyakogusa Predicted Gene

Lj0g3v0113899.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0113899.1 Non Chatacterized Hit- tr|F0ZAQ4|F0ZAQ4_DICPU
Putative uncharacterized protein (Fragment) OS=Dictyos,36.17,3.5,
,CUFF.6624.1
         (339 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu...    66   1e-10

>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (88%)
          Length = 764

 Score = 65.9 bits (33), Expect = 1e-10
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 80  gggagacaagggcatataaaaggtcacatggtgttgtcttagaggactt 128
           |||||| |||| | |||||||||||||||||| ||||||||||||||||
Sbjct: 177 gggagagaaggtcttataaaaggtcacatggtcttgtcttagaggactt 129