Miyakogusa Predicted Gene
- Lj0g3v0113889.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0113889.1 Non Chatacterized Hit- tr|I1J442|I1J442_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,80,9e-37,FAMILY NOT
NAMED,NULL; Auxin_inducible,Auxin responsive SAUR protein,CUFF.6625.1
(275 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu... 105 1e-22
gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind... 94 5e-19
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind... 88 3e-17
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu... 80 8e-15
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu... 62 2e-09
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu... 50 7e-06
>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (80%)
Length = 528
Score = 105 bits (53), Expect = 1e-22
Identities = 140/169 (82%)
Strand = Plus / Plus
Query: 56 cttcaaaagctgtggacgtgccaaaaggatatcttgcagtttatgtgggagagaaaatga 115
|||||||| ||| || |||||||| |||||||||||||| ||||| ||||| |||| ||
Sbjct: 147 cttcaaaatctgcagaagtgccaaagggatatcttgcagtgtatgttggagataaaacga 206
Query: 116 agaggtttgtgatccccatatcatacttgaggcaaacatcattccaagaattgctgaacc 175
|| ||||||||||||| ||||||||| ||| ||| | ||||| ||||| || || | |
Sbjct: 207 agcggtttgtgatccctatatcatacctgaaccaaccttcatttcaagagttactacatc 266
Query: 176 aagctgaggaacaatttgggtatgaccatccaatgggtggtcttacaat 224
|||| || ||| ||||||| ||||| |||||||| |||||||| |||||
Sbjct: 267 aagccgaagaagaatttggatatgatcatccaataggtggtctcacaat 315
>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
Glycine max|Rep: Auxin-induced protein 6B - Glycine max
(Soybean), complete
Length = 494
Score = 93.7 bits (47), Expect = 5e-19
Identities = 122/147 (82%)
Strand = Plus / Minus
Query: 85 tatcttgcagtttatgtgggagagaaaatgaagaggtttgtgatccccatatcatacttg 144
||||||||||| ||||| ||||| || |||||||||||| ||||| |||||||||||
Sbjct: 304 tatcttgcagtgtatgttggagaagaacagaagaggtttgtaatccctgtatcatacttg 245
Query: 145 aggcaaacatcattccaagaattgctgaaccaagctgaggaacaatttgggtatgaccat 204
| ||| | ||||| ||||||||||||| ||||||||||| | ||||| ||||| |||
Sbjct: 244 aaccaaccttcatttcaagaattgctgagtcaagctgaggacgagtttggatatgatcat 185
Query: 205 ccaatgggtggtcttacaatcccttgc 231
|| |||||||| || ||||| ||||||
Sbjct: 184 cccatgggtggcctcacaattccttgc 158
>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
n=1; Glycine max|Rep: Auxin-induced protein 15A -
Glycine max (Soybean), partial (90%)
Length = 494
Score = 87.7 bits (44), Expect = 3e-17
Identities = 128/156 (82%)
Strand = Plus / Plus
Query: 76 ccaaaaggatatcttgcagtttatgtgggagagaaaatgaagaggtttgtgatccccata 135
|||||||| ||||||||||| ||||| | |||||||||||| ||||||||||||||||
Sbjct: 173 ccaaaaggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatt 232
Query: 136 tcatacttgaggcaaacatcattccaagaattgctgaaccaagctgaggaacaatttggg 195
|||||| ||| ||| | ||||| |||||| | | | ||||||||| ||| ||| ||
Sbjct: 233 tcatacctgaatcaaccttcatttcaagaactattaagccaagctgaagaaaaatacgga 292
Query: 196 tatgaccatccaatgggtggtcttacaatcccttgc 231
||||| |||||| |||||||||| |||| ||||||
Sbjct: 293 tatgatcatccagtgggtggtctcgcaattccttgc 328
>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (88%)
Length = 764
Score = 79.8 bits (40), Expect = 8e-15
Identities = 170/213 (79%), Gaps = 4/213 (1%)
Strand = Plus / Plus
Query: 58 tcaaaagctgtggacgtgccaaaaggatatcttgcagtttatgtgggagagaaaatgaag 117
||||||| ||| ||||||||||| |||||| ||||||||||| |||||||| |||||
Sbjct: 451 tcaaaagttgtagacgtgccaaagggatatattgcagtttat----gagagaaactgaag 506
Query: 118 aggtttgtgatccccatatcatacttgaggcaaacatcattccaagaattgctgaaccaa 177
|| |||||||||||||||||| |||| ||| || ||| |||| || || | |||
Sbjct: 507 ccgtgtgtgatccccatatcatatttgaaccaaccacaatttcaaggcttcctaagtcaa 566
Query: 178 gctgaggaacaatttgggtatgaccatccaatgggtggtcttacaatcccttgcggagaa 237
||||||||| | ||||| |||||||||| | ||||||||| || || |||||| | |||
Sbjct: 567 gctgaggaagagtttggatatgaccatcacacgggtggtctcacgattccttgcagtgaa 626
Query: 238 gacatgttcttagatattacttctcacttgaat 270
|| | ||| | |||| |||||||||||||||
Sbjct: 627 gatgtcttccaacatataacttctcacttgaat 659
>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (90%)
Length = 491
Score = 61.9 bits (31), Expect = 2e-09
Identities = 112/139 (80%)
Strand = Plus / Plus
Query: 86 atcttgcagtttatgtgggagagaaaatgaagaggtttgtgatccccatatcatacttga 145
|||||||||| ||||| ||||| |||||| | |||||||||| || ||||||||||||
Sbjct: 188 atcttgcagtctatgttggagatgaaatgaggcggtttgtgattccagtatcatacttga 247
Query: 146 ggcaaacatcattccaagaattgctgaaccaagctgaggaacaatttgggtatgaccatc 205
||| | || || ||||| || ||| | ||||| || ||| ||||||| ||||| ||||
Sbjct: 248 accaaccttcttttcaagagttactgcatcaagcagaagaagaatttggatatgatcatc 307
Query: 206 caatgggtggtcttacaat 224
||| |||||||| |||||
Sbjct: 308 caacaggtggtctcacaat 326
>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (91%)
Length = 523
Score = 50.1 bits (25), Expect = 7e-06
Identities = 106/133 (79%)
Strand = Plus / Plus
Query: 76 ccaaaaggatatcttgcagtttatgtgggagagaaaatgaagaggtttgtgatccccata 135
|||||||| |||||||||| ||||| ||||| |||||| | |||| ||||| || ||
Sbjct: 177 ccaaaaggccatcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagta 236
Query: 136 tcatacttgaggcaaacatcattccaagaattgctgaaccaagctgaggaacaatttggg 195
|||||||||| ||| | ||||| ||||| || || | ||||| || ||| |||||||
Sbjct: 237 tcatacttgaaccaaccttcatttcaagagttactatatcaagccgaagaagaatttgga 296
Query: 196 tatgaccatccaa 208
||||| |||||||
Sbjct: 297 tatgatcatccaa 309