Miyakogusa Predicted Gene

Lj0g3v0112319.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0112319.1 Non Chatacterized Hit- tr|D7TTF9|D7TTF9_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,67.92,0.000000000002, ,CUFF.6512.1
         (177 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61268 similar to UniRef100_A7QT50 Cluster: Chromosome...   192   5e-49
gnl|LJGI|BW598818                                                     119   6e-27
gnl|LJGI|TC82532 homologue to UniRef100_Q8S8Z9 Cluster: Syringol...   119   6e-27

>gnl|LJGI|TC61268 similar to UniRef100_A7QT50 Cluster: Chromosome undetermined
            scaffold_165, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome undetermined scaffold_165, whole
            genome shotgun sequence - Vitis vinifera (Grape), partial
            (93%)
          Length = 1496

 Score =  192 bits (97), Expect = 5e-49
 Identities = 114/122 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    atggaccttccccctnnnnnnnttaatttaatatcgtgtgagtcattgactcacatatca 60
            |||||||||||||||       ||||||||||||||||||||||||||||||||||||||
Sbjct: 1415 atggaccttccccctaaaaaaattaatttaatatcgtgtgagtcattgactcacatatca 1356

                                                                        
Query: 61   gatattaaactgataagaacagatactacacttgatcttagccaaaaggccgagaaaggt 120
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1355 aatattaaactgataagaacagatactacacttgatcttagccaaaaggccgagaaaggt 1296

              
Query: 121  at 122
            ||
Sbjct: 1295 at 1294


>gnl|LJGI|BW598818 
          Length = 170

 Score =  119 bits (60), Expect = 6e-27
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                      
Query: 25 aatttaatatcgtgtgagtcattgactcacatatcagatattaaactgataagaacagat 84
          |||||||||||||||||| ||||  |||||||||||||||||||||||||||||||||||
Sbjct: 79 aatttaatatcgtgtgagccattagctcacatatcagatattaaactgataagaacagat 20

                      
Query: 85 actacacttgat 96
          ||||||||||||
Sbjct: 19 actacacttgat 8


>gnl|LJGI|TC82532 homologue to UniRef100_Q8S8Z9 Cluster: Syringolide-induced
          protein 1-3-1B; n=1; Glycine max|Rep:
          Syringolide-induced protein 1-3-1B - Glycine max
          (Soybean), partial (26%)
          Length = 542

 Score =  119 bits (60), Expect = 6e-27
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                      
Query: 25 aatttaatatcgtgtgagtcattgactcacatatcagatattaaactgataagaacagat 84
          |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 72 aatttaatatcgtgtgagccattggctcacatatcagatattaaactgataagaacagat 13

                  
Query: 85 actacact 92
          ||||||||
Sbjct: 12 actacact 5