Miyakogusa Predicted Gene

Lj0g3v0110959.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0110959.1 Non Chatacterized Hit- tr|E4QFE3|E4QFE3_BORBN
Putative uncharacterized protein OS=Borrelia
burgdorfe,27.88,2.6,seg,NULL,CUFF.6411.1
         (352 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO029116 similar to UniRef100_A8MQG0 Cluster: Uncharact...    54   6e-07
gnl|LJGI|AV775660                                                      50   9e-06
gnl|LJGI|AV766044 homologue to UniRef100_Q54DW7 Cluster: Pleckst...    50   9e-06

>gnl|LJGI|GO029116 similar to UniRef100_A8MQG0 Cluster: Uncharacterized protein
           At1g11850.4; n=1; Arabidopsis thaliana|Rep:
           Uncharacterized protein At1g11850.4 - Arabidopsis
           thaliana (Mouse-ear cress), partial (22%)
          Length = 402

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 29  ttcatcttctccatctcatcatcttcatccc 59
           |||||||| ||||||||||||||||||||||
Sbjct: 121 ttcatcttttccatctcatcatcttcatccc 151


>gnl|LJGI|AV775660 
          Length = 487

 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 29  ttcatcttctccatctcatcatcttcatc 57
           ||||||||||||||| |||||||||||||
Sbjct: 149 ttcatcttctccatcccatcatcttcatc 177


>gnl|LJGI|AV766044 homologue to UniRef100_Q54DW7 Cluster: Pleckstrin homology (PH)
           domain-containing protein; n=1; Dictyostelium
           discoideum|Rep:, partial (1%)
          Length = 360

 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 29  ttcatcttctccatctcatcatcttcatcccct 61
           ||||||||||| ||||||||||||||| |||||
Sbjct: 254 ttcatcttctcaatctcatcatcttcagcccct 286