Miyakogusa Predicted Gene

Lj0g3v0110329.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0110329.1 tr|G7KJN2|G7KJN2_MEDTR Resistance protein
OS=Medicago truncatula GN=MTR_6g074840 PE=4
SV=1,49.48,0.000000000000001,P-loop containing nucleoside triphosphate
hydrolases,NULL; DISEASERSIST,Disease resistance protein;
,gene.g8329.t1.1
         (693 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC599911 weakly similar to UniRef100_A7PQB6 Cluster: Ch...    80   2e-14
gnl|LJGI|FS339666 weakly similar to UniRef100_Q6Y4S2 Cluster: Re...    58   8e-08

>gnl|LJGI|DC599911 weakly similar to UniRef100_A7PQB6 Cluster: Chromosome chr18
           scaffold_24, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr18 scaffold_24, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (12%)
          Length = 593

 Score = 79.8 bits (40), Expect = 2e-14
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 204 gtctcaatcagaatacatgtttattggaaagattgtggaa 243
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 554 gtctcaatcagaatacatgtttattggaaagattgtggaa 593


>gnl|LJGI|FS339666 weakly similar to UniRef100_Q6Y4S2 Cluster: Resistance-like protein
           RNEAU-2; n=1; Glycine max|Rep: Resistance-like protein
           RNEAU-2 - Glycine max (Soybean), complete
          Length = 765

 Score = 58.0 bits (29), Expect = 8e-08
 Identities = 97/119 (81%), Gaps = 3/119 (2%)
 Strand = Plus / Plus

                                                                       
Query: 16  attgtggaagaggtctctgaaaagattaatcgcactcctttacatgttgcttataagccg 75
           ||||| ||||| |||||  || |||| |||| ||||| ||||||||||| | |||| || 
Sbjct: 84  attgttgaagaagtctcaaaatagataaatcacactcttttacatgttgttgataaccca 143

                                                                      
Query: 76  gttgggctggagtctccggtgctagcagtggtgtcttctctcctaggacttgggtctga 134
            ||||| |||| ||| ||||||||| ||||  |   |||||||||||||||||||||||
Sbjct: 144 attgggttggactctgcggtgctagaagtgcgg---tctctcctaggacttgggtctga 199