Miyakogusa Predicted Gene
- Lj0g3v0107629.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0107629.1 Non Chatacterized Hit- tr|G7LAI0|G7LAI0_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,60.44,6e-18,DLC,Dynein light chain, type 1/2; no
description,Dynein light chain, type 1/2; Dynein_light,Dynein
l,CUFF.6154.1
(423 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC68141 similar to UniRef100_A7P3T2 Cluster: Chromosome... 176 7e-44
gnl|LJGI|TC72108 homologue to UniRef100_A7P3T2 Cluster: Chromoso... 165 3e-40
gnl|LJGI|BW596802 homologue to UniRef100_A7P3T2 Cluster: Chromos... 151 4e-36
>gnl|LJGI|TC68141 similar to UniRef100_A7P3T2 Cluster: Chromosome chr1 scaffold_5,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr1 scaffold_5, whole genome shotgun sequence
- Vitis vinifera (Grape), partial (93%)
Length = 1445
Score = 176 bits (89), Expect = 7e-44
Identities = 224/269 (83%)
Strand = Plus / Plus
Query: 145 gtcagagcttgtgatatgcctctccctttgcagaatcatgctttccaatgcgcgcgtcaa 204
||||| |||||||| |||||||||| ||||||||| | ||| || ||||| ||| |
Sbjct: 806 gtcagggcttgtgacatgcctctccttttgcagaaccgtgccttttgttgcgctcgtgat 865
Query: 205 cacctcgattctatgcctgccaagaagcttggcagtaaacttctggcactggcacttaag 264
| || ||||||||||| || || ||||||| || |||| ||||| ||| | ||||||
Sbjct: 866 cttctggattctatgccagcaaataagcttgacaccaaacgcctggccctgacccttaag 925
Query: 265 aaggaatttgattcttcatatggtcctgcttggcactgcattgtgggtactagctttggt 324
|||||||||||||| || |||||||| |||||||||||||||||||| ||||||||||
Sbjct: 926 aaggaatttgattcatcctatggtccagcttggcactgcattgtgggatctagctttggc 985
Query: 325 tcctatgtcacacattctgttggtgggtttttgtacttttccattgataaggtttttatc 384
|| ||||| || |||||| ||||||| || ||||| ||||||||||| ||||| | |||
Sbjct: 986 tcatatgtgactcattctcttggtggattcttgtatttttccattgacaaggtctacatc 1045
Query: 385 cttctcttcaagacagctgttcaaccatt 413
||||||||||||||||||||| |||||||
Sbjct: 1046 cttctcttcaagacagctgttgaaccatt 1074
>gnl|LJGI|TC72108 homologue to UniRef100_A7P3T2 Cluster: Chromosome chr1 scaffold_5,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr1 scaffold_5, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (49%)
Length = 489
Score = 165 bits (83), Expect = 3e-40
Identities = 137/155 (88%)
Strand = Plus / Plus
Query: 259 cttaagaaggaatttgattcttcatatggtcctgcttggcactgcattgtgggtactagc 318
|||||||||||||||||||| || |||||||| |||||||||||||||||||| |||||
Sbjct: 62 cttaagaaggaatttgattcatcctatggtccagcttggcactgcattgtgggatctagc 121
Query: 319 tttggttcctatgtcacacattctgttggtgggtttttgtacttttccattgataaggtt 378
||||| || ||||| || |||||| ||||||| || ||||| ||||||||||| |||||
Sbjct: 122 tttggctcatatgtgactcattctcttggtggattcttgtatttttccattgacaaggtc 181
Query: 379 tttatccttctcttcaagacagctgttcaaccatt 413
| |||||||||||||||||||||||| |||||||
Sbjct: 182 tacatccttctcttcaagacagctgttgaaccatt 216
>gnl|LJGI|BW596802 homologue to UniRef100_A7P3T2 Cluster: Chromosome chr1 scaffold_5,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr1 scaffold_5, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (41%)
Length = 533
Score = 151 bits (76), Expect = 4e-36
Identities = 130/148 (87%)
Strand = Plus / Plus
Query: 266 aggaatttgattcttcatatggtcctgcttggcactgcattgtgggtactagctttggtt 325
||||||||||||| || |||||||| |||||||||||||||||||| |||||||||| |
Sbjct: 86 aggaatttgattcatcctatggtccagcttggcactgcattgtgggatctagctttggct 145
Query: 326 cctatgtcacacattctgttggtgggtttttgtacttttccattgataaggtttttatcc 385
| ||||| || |||||| ||||||| || ||||| ||||||||||| ||||| | ||||
Sbjct: 146 catatgtgactcattctcttggtggattcttgtatttttccattgacaaggtctacatcc 205
Query: 386 ttctcttcaagacagctgttcaaccatt 413
|||||||||||||||||||| |||||||
Sbjct: 206 ttctcttcaagacagctgttgaaccatt 233