Miyakogusa Predicted Gene

Lj0g3v0107619.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0107619.1 tr|K0NQ31|K0NQ31_9DELT Two component system
sensor histidine kinase, hybrid OS=Desulfobacula
toluoli,41.67,1.9,seg,NULL,CUFF.6153.1
         (276 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS342767 UniRef100_Q93FJ5 Cluster: EspB; n=1; Citrobact...   210   3e-54
gnl|LJGI|TC78642                                                      186   5e-47
gnl|LJGI|FS343316                                                     167   4e-41
gnl|LJGI|TC79040 similar to UniRef100_A7PM44 Cluster: Oleosin; n...   151   3e-36
gnl|LJGI|DC592937 similar to UniRef100_Q10QG3 Cluster: Cupin fam...   143   6e-34
gnl|LJGI|TC80736                                                      143   6e-34
gnl|LJGI|TC81654                                                      101   2e-21

>gnl|LJGI|FS342767 UniRef100_Q93FJ5 Cluster: EspB; n=1; Citrobacter rodentium|Rep:
           EspB - Citrobacter rodentium, partial (5%)
          Length = 750

 Score =  210 bits (106), Expect = 3e-54
 Identities = 106/106 (100%)
 Strand = Plus / Plus

                                                                       
Query: 8   ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 216 ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 275

                                                         
Query: 68  ttgggaccggagatgggagcgtttggggccagagaggttgtgaccg 113
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 276 ttgggaccggagatgggagcgtttggggccagagaggttgtgaccg 321



 Score =  129 bits (65), Expect = 1e-29
 Identities = 79/86 (91%)
 Strand = Plus / Plus

                                                                       
Query: 191 ggtggctgctagggtttctggaccctctgnnnnnnngttctgtagctgctagggttccag 250
           |||||||||||||||||||||||||||||       ||||||||||||||||||||||||
Sbjct: 399 ggtggctgctagggtttctggaccctctgtttttttgttctgtagctgctagggttccag 458

                                     
Query: 251 acgcgttttggcagagtgtatggtag 276
           ||||||||||||||||||||||||||
Sbjct: 459 acgcgttttggcagagtgtatggtag 484


>gnl|LJGI|TC78642 
          Length = 523

 Score =  186 bits (94), Expect = 5e-47
 Identities = 103/106 (97%)
 Strand = Plus / Plus

                                                                       
Query: 8   ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||
Sbjct: 68  ggagcgtggcctttgaggcggatcgggttgtttggtggtggatcggggcgtttggaggca 127

                                                         
Query: 68  ttgggaccggagatgggagcgtttggggccagagaggttgtgaccg 113
           |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 128 ttgggaccggagatgggagcgtttggggccagagaggtagtgaccg 173



 Score = 63.9 bits (32), Expect = 5e-10
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 191 ggtggctgctagggtttctggaccctctgnnnnnnngttctgtagctgctagggttccag 250
           |||||||||||||||||||||||||||||       |||||| ||||||||||||| |||
Sbjct: 257 ggtggctgctagggtttctggaccctctgtttttttgttctgcagctgctagggtttcag 316

            
Query: 251 a 251
           |
Sbjct: 317 a 317



 Score = 50.1 bits (25), Expect = 7e-06
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 245 ttccagacgcgttttggcagagtgtatgg 273
           ||||| |||||||||||||||||||||||
Sbjct: 394 ttccatacgcgttttggcagagtgtatgg 422


>gnl|LJGI|FS343316 
          Length = 754

 Score =  167 bits (84), Expect = 4e-41
 Identities = 99/104 (95%)
 Strand = Plus / Plus

                                                                       
Query: 8   ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
           |||||||||| |||||||||||||||||||| ||||||||||||||||||||||| | ||
Sbjct: 72  ggagcgtggcttttgaggcggatcgggttgtttggtggtggatcggggcgtttggcggca 131

                                                       
Query: 68  ttgggaccggagatgggagcgtttggggccagagaggttgtgac 111
           |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 132 ttgggaccggagatgggagcgtttggggccagagaggtagtgac 175


>gnl|LJGI|TC79040 similar to UniRef100_A7PM44 Cluster: Oleosin; n=1; Vitis
           vinifera|Rep: Oleosin - Vitis vinifera (Grape), partial
           (12%)
          Length = 940

 Score =  151 bits (76), Expect = 3e-36
 Identities = 97/104 (93%)
 Strand = Plus / Plus

                                                                       
Query: 8   ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
           |||||||||| |||||||| |||| |||||| ||||||||||||||||||||||| | ||
Sbjct: 205 ggagcgtggcttttgaggcagatcaggttgtttggtggtggatcggggcgtttggcggca 264

                                                       
Query: 68  ttgggaccggagatgggagcgtttggggccagagaggttgtgac 111
           |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 265 ttgggaccggagatgggagcgtttggggccagagaggtagtgac 308


>gnl|LJGI|DC592937 similar to UniRef100_Q10QG3 Cluster: Cupin family protein,
           expressed; n=2; Oryza sativa Japonica Group|Rep: Cupin
           family protein, expressed - Oryza sativa subsp. japonica
           (Rice), partial (4%)
          Length = 592

 Score =  143 bits (72), Expect = 6e-34
 Identities = 96/104 (92%)
 Strand = Plus / Plus

                                                                       
Query: 8   ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
           |||||||||| |||||||| |||| |||||| ||||||||||||||||||||||| | ||
Sbjct: 116 ggagcgtggcttttgaggcagatcaggttgtttggtggtggatcggggcgtttggcggca 175

                                                       
Query: 68  ttgggaccggagatgggagcgtttggggccagagaggttgtgac 111
           ||||||||||||||||||||||||| |||||||||||| |||||
Sbjct: 176 ttgggaccggagatgggagcgtttgtggccagagaggtagtgac 219


>gnl|LJGI|TC80736 
          Length = 1154

 Score =  143 bits (72), Expect = 6e-34
 Identities = 96/104 (92%)
 Strand = Plus / Plus

                                                                       
Query: 8   ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
           |||||||||| |||||||| |||| |||||| ||||||||||||||||||||||| | ||
Sbjct: 110 ggagcgtggcttttgaggcagatcaggttgtttggtggtggatcggggcgtttggcggca 169

                                                       
Query: 68  ttgggaccggagatgggagcgtttggggccagagaggttgtgac 111
           ||||||||||||||||||||||||| |||||||||||| |||||
Sbjct: 170 ttgggaccggagatgggagcgtttgtggccagagaggtagtgac 213


>gnl|LJGI|TC81654 
          Length = 486

 Score =  101 bits (51), Expect = 2e-21
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                  
Query: 8   ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttgg 62
           ||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 281 ggagcgtggcctttgaggcggatcgggttgtttggtggtggatcggggcgtttgg 335



 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 86  gcgtttggggccagagaggttgtgac 111
           ||||||||||||||||||||||||||
Sbjct: 328 gcgtttggggccagagaggttgtgac 353