Miyakogusa Predicted Gene
- Lj0g3v0107619.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0107619.1 tr|K0NQ31|K0NQ31_9DELT Two component system
sensor histidine kinase, hybrid OS=Desulfobacula
toluoli,41.67,1.9,seg,NULL,CUFF.6153.1
(276 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS342767 UniRef100_Q93FJ5 Cluster: EspB; n=1; Citrobact... 210 3e-54
gnl|LJGI|TC78642 186 5e-47
gnl|LJGI|FS343316 167 4e-41
gnl|LJGI|TC79040 similar to UniRef100_A7PM44 Cluster: Oleosin; n... 151 3e-36
gnl|LJGI|DC592937 similar to UniRef100_Q10QG3 Cluster: Cupin fam... 143 6e-34
gnl|LJGI|TC80736 143 6e-34
gnl|LJGI|TC81654 101 2e-21
>gnl|LJGI|FS342767 UniRef100_Q93FJ5 Cluster: EspB; n=1; Citrobacter rodentium|Rep:
EspB - Citrobacter rodentium, partial (5%)
Length = 750
Score = 210 bits (106), Expect = 3e-54
Identities = 106/106 (100%)
Strand = Plus / Plus
Query: 8 ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 216 ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 275
Query: 68 ttgggaccggagatgggagcgtttggggccagagaggttgtgaccg 113
||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 276 ttgggaccggagatgggagcgtttggggccagagaggttgtgaccg 321
Score = 129 bits (65), Expect = 1e-29
Identities = 79/86 (91%)
Strand = Plus / Plus
Query: 191 ggtggctgctagggtttctggaccctctgnnnnnnngttctgtagctgctagggttccag 250
||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 399 ggtggctgctagggtttctggaccctctgtttttttgttctgtagctgctagggttccag 458
Query: 251 acgcgttttggcagagtgtatggtag 276
||||||||||||||||||||||||||
Sbjct: 459 acgcgttttggcagagtgtatggtag 484
>gnl|LJGI|TC78642
Length = 523
Score = 186 bits (94), Expect = 5e-47
Identities = 103/106 (97%)
Strand = Plus / Plus
Query: 8 ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||
Sbjct: 68 ggagcgtggcctttgaggcggatcgggttgtttggtggtggatcggggcgtttggaggca 127
Query: 68 ttgggaccggagatgggagcgtttggggccagagaggttgtgaccg 113
|||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 128 ttgggaccggagatgggagcgtttggggccagagaggtagtgaccg 173
Score = 63.9 bits (32), Expect = 5e-10
Identities = 52/61 (85%)
Strand = Plus / Plus
Query: 191 ggtggctgctagggtttctggaccctctgnnnnnnngttctgtagctgctagggttccag 250
||||||||||||||||||||||||||||| |||||| ||||||||||||| |||
Sbjct: 257 ggtggctgctagggtttctggaccctctgtttttttgttctgcagctgctagggtttcag 316
Query: 251 a 251
|
Sbjct: 317 a 317
Score = 50.1 bits (25), Expect = 7e-06
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 245 ttccagacgcgttttggcagagtgtatgg 273
||||| |||||||||||||||||||||||
Sbjct: 394 ttccatacgcgttttggcagagtgtatgg 422
>gnl|LJGI|FS343316
Length = 754
Score = 167 bits (84), Expect = 4e-41
Identities = 99/104 (95%)
Strand = Plus / Plus
Query: 8 ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
|||||||||| |||||||||||||||||||| ||||||||||||||||||||||| | ||
Sbjct: 72 ggagcgtggcttttgaggcggatcgggttgtttggtggtggatcggggcgtttggcggca 131
Query: 68 ttgggaccggagatgggagcgtttggggccagagaggttgtgac 111
|||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 132 ttgggaccggagatgggagcgtttggggccagagaggtagtgac 175
>gnl|LJGI|TC79040 similar to UniRef100_A7PM44 Cluster: Oleosin; n=1; Vitis
vinifera|Rep: Oleosin - Vitis vinifera (Grape), partial
(12%)
Length = 940
Score = 151 bits (76), Expect = 3e-36
Identities = 97/104 (93%)
Strand = Plus / Plus
Query: 8 ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
|||||||||| |||||||| |||| |||||| ||||||||||||||||||||||| | ||
Sbjct: 205 ggagcgtggcttttgaggcagatcaggttgtttggtggtggatcggggcgtttggcggca 264
Query: 68 ttgggaccggagatgggagcgtttggggccagagaggttgtgac 111
|||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 265 ttgggaccggagatgggagcgtttggggccagagaggtagtgac 308
>gnl|LJGI|DC592937 similar to UniRef100_Q10QG3 Cluster: Cupin family protein,
expressed; n=2; Oryza sativa Japonica Group|Rep: Cupin
family protein, expressed - Oryza sativa subsp. japonica
(Rice), partial (4%)
Length = 592
Score = 143 bits (72), Expect = 6e-34
Identities = 96/104 (92%)
Strand = Plus / Plus
Query: 8 ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
|||||||||| |||||||| |||| |||||| ||||||||||||||||||||||| | ||
Sbjct: 116 ggagcgtggcttttgaggcagatcaggttgtttggtggtggatcggggcgtttggcggca 175
Query: 68 ttgggaccggagatgggagcgtttggggccagagaggttgtgac 111
||||||||||||||||||||||||| |||||||||||| |||||
Sbjct: 176 ttgggaccggagatgggagcgtttgtggccagagaggtagtgac 219
>gnl|LJGI|TC80736
Length = 1154
Score = 143 bits (72), Expect = 6e-34
Identities = 96/104 (92%)
Strand = Plus / Plus
Query: 8 ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttggagaca 67
|||||||||| |||||||| |||| |||||| ||||||||||||||||||||||| | ||
Sbjct: 110 ggagcgtggcttttgaggcagatcaggttgtttggtggtggatcggggcgtttggcggca 169
Query: 68 ttgggaccggagatgggagcgtttggggccagagaggttgtgac 111
||||||||||||||||||||||||| |||||||||||| |||||
Sbjct: 170 ttgggaccggagatgggagcgtttgtggccagagaggtagtgac 213
>gnl|LJGI|TC81654
Length = 486
Score = 101 bits (51), Expect = 2e-21
Identities = 54/55 (98%)
Strand = Plus / Plus
Query: 8 ggagcgtggcctttgaggcggatcgggttgtatggtggtggatcggggcgtttgg 62
||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 281 ggagcgtggcctttgaggcggatcgggttgtttggtggtggatcggggcgtttgg 335
Score = 52.0 bits (26), Expect = 2e-06
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 86 gcgtttggggccagagaggttgtgac 111
||||||||||||||||||||||||||
Sbjct: 328 gcgtttggggccagagaggttgtgac 353