Miyakogusa Predicted Gene

Lj0g3v0107019.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0107019.1 Non Chatacterized Hit- tr|D7SLZ5|D7SLZ5_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,51.8,7e-18,Stm1_N,Stm1, N-terminal; seg,NULL; NUCLEAR RNA BINDING
PROTEIN A-LIKE PROTEIN,NULL; HYALURONIC
ACID-,NODE_30026_length_419_cov_520.326965.path2.1
         (402 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70839 similar to UniRef100_O04237 Cluster: Transcript...   478   e-134
gnl|LJGI|TC78973 similar to UniRef100_O04237 Cluster: Transcript...    54   7e-07
gnl|LJGI|TC59679 similar to UniRef100_O04237 Cluster: Transcript...    54   7e-07

>gnl|LJGI|TC70839 similar to UniRef100_O04237 Cluster: Transcription factor; n=1;
           Vicia faba var. minor|Rep: Transcription factor - Vicia
           faba var. minor, partial (85%)
          Length = 1665

 Score =  478 bits (241), Expect = e-134
 Identities = 241/241 (100%)
 Strand = Plus / Plus

                                                                       
Query: 145 aagccacttcctcctgctcaggctgtgagggatgccagaaatgaaccatcacgaggaggc 204
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 aagccacttcctcctgctcaggctgtgagggatgccagaaatgaaccatcacgaggaggc 475

                                                                       
Query: 205 cgtggaggtgcaagaggtgctggtcgtggatttggacgtggtcgtggtttcaatcgtgac 264
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 476 cgtggaggtgcaagaggtgctggtcgtggatttggacgtggtcgtggtttcaatcgtgac 535

                                                                       
Query: 265 ttctccaatgatgagaactcattccctgcctctggagcccctgataatctgggtcctttt 324
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 536 ttctccaatgatgagaactcattccctgcctctggagcccctgataatctgggtcctttt 595

                                                                       
Query: 325 gaaggtgattctgagaaggcttcagaaaggcgtggttatggtgcaccacgaggtccttat 384
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 596 gaaggtgattctgagaaggcttcagaaaggcgtggttatggtgcaccacgaggtccttat 655

            
Query: 385 c 385
           |
Sbjct: 656 c 656



 Score =  264 bits (133), Expect = 4e-70
 Identities = 133/133 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcgaccatgaacccttttgatttgttgggtgatgacgctgaggatccttctcagctc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 245 atggcgaccatgaacccttttgatttgttgggtgatgacgctgaggatccttctcagctc 304

                                                                       
Query: 61  atcgctgccgaacagctcaaggctgcggccgcggcggcgactgctcctcccaagaaagcg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 305 atcgctgccgaacagctcaaggctgcggccgcggcggcgactgctcctcccaagaaagcg 364

                        
Query: 121 gcgggggctcagg 133
           |||||||||||||
Sbjct: 365 gcgggggctcagg 377


>gnl|LJGI|TC78973 similar to UniRef100_O04237 Cluster: Transcription factor; n=1;
           Vicia faba var. minor|Rep: Transcription factor - Vicia
           faba var. minor, partial (34%)
          Length = 739

 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 1   atggcgaccatgaacccttttgatttgttgggtgatgacgctgagga 47
           ||||| |||||||| |||||||||||| | |||||||| ||||||||
Sbjct: 200 atggcaaccatgaatccttttgatttgctcggtgatgatgctgagga 246


>gnl|LJGI|TC59679 similar to UniRef100_O04237 Cluster: Transcription factor; n=1;
           Vicia faba var. minor|Rep: Transcription factor - Vicia
           faba var. minor, partial (85%)
          Length = 1699

 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 1   atggcgaccatgaacccttttgatttgttgggtgatgacgctgagga 47
           ||||| |||||||| |||||||||||| | |||||||| ||||||||
Sbjct: 204 atggcaaccatgaatccttttgatttgctcggtgatgatgctgagga 250