Miyakogusa Predicted Gene
- Lj0g3v0107019.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0107019.1 Non Chatacterized Hit- tr|D7SLZ5|D7SLZ5_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,51.8,7e-18,Stm1_N,Stm1, N-terminal; seg,NULL; NUCLEAR RNA BINDING
PROTEIN A-LIKE PROTEIN,NULL; HYALURONIC
ACID-,NODE_30026_length_419_cov_520.326965.path2.1
(402 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC70839 similar to UniRef100_O04237 Cluster: Transcript... 478 e-134
gnl|LJGI|TC78973 similar to UniRef100_O04237 Cluster: Transcript... 54 7e-07
gnl|LJGI|TC59679 similar to UniRef100_O04237 Cluster: Transcript... 54 7e-07
>gnl|LJGI|TC70839 similar to UniRef100_O04237 Cluster: Transcription factor; n=1;
Vicia faba var. minor|Rep: Transcription factor - Vicia
faba var. minor, partial (85%)
Length = 1665
Score = 478 bits (241), Expect = e-134
Identities = 241/241 (100%)
Strand = Plus / Plus
Query: 145 aagccacttcctcctgctcaggctgtgagggatgccagaaatgaaccatcacgaggaggc 204
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 aagccacttcctcctgctcaggctgtgagggatgccagaaatgaaccatcacgaggaggc 475
Query: 205 cgtggaggtgcaagaggtgctggtcgtggatttggacgtggtcgtggtttcaatcgtgac 264
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 476 cgtggaggtgcaagaggtgctggtcgtggatttggacgtggtcgtggtttcaatcgtgac 535
Query: 265 ttctccaatgatgagaactcattccctgcctctggagcccctgataatctgggtcctttt 324
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 536 ttctccaatgatgagaactcattccctgcctctggagcccctgataatctgggtcctttt 595
Query: 325 gaaggtgattctgagaaggcttcagaaaggcgtggttatggtgcaccacgaggtccttat 384
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 596 gaaggtgattctgagaaggcttcagaaaggcgtggttatggtgcaccacgaggtccttat 655
Query: 385 c 385
|
Sbjct: 656 c 656
Score = 264 bits (133), Expect = 4e-70
Identities = 133/133 (100%)
Strand = Plus / Plus
Query: 1 atggcgaccatgaacccttttgatttgttgggtgatgacgctgaggatccttctcagctc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 245 atggcgaccatgaacccttttgatttgttgggtgatgacgctgaggatccttctcagctc 304
Query: 61 atcgctgccgaacagctcaaggctgcggccgcggcggcgactgctcctcccaagaaagcg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 305 atcgctgccgaacagctcaaggctgcggccgcggcggcgactgctcctcccaagaaagcg 364
Query: 121 gcgggggctcagg 133
|||||||||||||
Sbjct: 365 gcgggggctcagg 377
>gnl|LJGI|TC78973 similar to UniRef100_O04237 Cluster: Transcription factor; n=1;
Vicia faba var. minor|Rep: Transcription factor - Vicia
faba var. minor, partial (34%)
Length = 739
Score = 54.0 bits (27), Expect = 7e-07
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 1 atggcgaccatgaacccttttgatttgttgggtgatgacgctgagga 47
||||| |||||||| |||||||||||| | |||||||| ||||||||
Sbjct: 200 atggcaaccatgaatccttttgatttgctcggtgatgatgctgagga 246
>gnl|LJGI|TC59679 similar to UniRef100_O04237 Cluster: Transcription factor; n=1;
Vicia faba var. minor|Rep: Transcription factor - Vicia
faba var. minor, partial (85%)
Length = 1699
Score = 54.0 bits (27), Expect = 7e-07
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 1 atggcgaccatgaacccttttgatttgttgggtgatgacgctgagga 47
||||| |||||||| |||||||||||| | |||||||| ||||||||
Sbjct: 204 atggcaaccatgaatccttttgatttgctcggtgatgatgctgagga 250