Miyakogusa Predicted Gene

Lj0g3v0106169.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0106169.1 tr|Q58ZF0|Q58ZF0_LOTCO Phenylalanine
ammonia-lyase (Fragment) OS=Lotus corniculatus PE=2
SV=1,94.12,7e-29,Lyase_aromatic,Aromatic amino acid lyase; no
description,NULL; L-aspartase-like,L-Aspartase-like;
SU,NODE_39058_length_229_cov_712.165955.path2.1
         (208 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77778 homologue to UniRef100_Q9SMK9 Cluster: Phenylal...   359   4e-99
gnl|LJGI|TC63525 UniRef100_A0PBZ0 Cluster: Phenylalanine ammonia...   133   5e-31
gnl|LJGI|TC80800 UniRef100_A0PBZ5 Cluster: Phenylalanine ammonia...   109   7e-24
gnl|LJGI|TC58817 UniRef100_A0PBZ2 Cluster: Phenylalanine ammonia...   107   3e-23
gnl|LJGI|TC58358 homologue to UniRef100_A0PBZ4 Cluster: Phenylal...   107   3e-23
gnl|LJGI|TC64569 homologue to UniRef100_A0PBZ4 Cluster: Phenylal...   101   2e-21
gnl|LJGI|TC61503 UniRef100_A0PBZ4 Cluster: Phenylalanine ammonia...   101   2e-21
gnl|LJGI|TC60002 UniRef100_A0PBZ3 Cluster: Phenylalanine ammonia...   101   2e-21
gnl|LJGI|TC59911 UniRef100_A0PBZ8 Cluster: Phenylalanine ammonia...    70   6e-12

>gnl|LJGI|TC77778 homologue to UniRef100_Q9SMK9 Cluster: Phenylalanine ammonia-lyase
           2; n=1; Cicer arietinum|Rep: Phenylalanine ammonia-lyase
           2 - Cicer arietinum (Chickpea) (Garbanzo), partial (46%)
          Length = 997

 Score =  359 bits (181), Expect = 4e-99
 Identities = 199/205 (97%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgatcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaac 60
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 252 atgatcgagagggagataaactcggtgaacgacgaccctctcattgatgtttcaaggaac 311

                                                                       
Query: 61  aaggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacact 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 aaggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacact 371

                                                                       
Query: 121 cgtctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagctcgtgacc 180
           ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
Sbjct: 372 cgtctcgccattgctgcaattgggaaactcatgtttgctcagttcaccgagctcgtgaac 431

                                    
Query: 181 gttttttccaacaacgttttgcctt 205
           |  ||||||||||||| ||||||||
Sbjct: 432 gacttttccaacaacggtttgcctt 456


>gnl|LJGI|TC63525 UniRef100_A0PBZ0 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
            japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
            japonicus, complete
          Length = 2384

 Score =  133 bits (67), Expect = 5e-31
 Identities = 145/171 (84%)
 Strand = Plus / Plus

                                                                        
Query: 3    gatcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaa 62
            ||||||||| ||||| || || ||||||||||||||| | ||||||||||| || |||||
Sbjct: 1179 gatcgagagagagattaattctgtgaacgacaaccctttgattgatgtttccagaaacaa 1238

                                                                        
Query: 63   ggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcg 122
            |||  | || || || |||||||| || ||||| ||||| ||||||||||| ||||| ||
Sbjct: 1239 ggccttgcacggtggtaatttccaagggacccctattggagtttccatggacaacacacg 1298

                                                               
Query: 123  tctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
            ||| ||| |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1299 tctggcccttgcagcaattggaaaactcatgtttgctcagttcactgagct 1349


>gnl|LJGI|TC80800 UniRef100_A0PBZ5 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
            japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
            japonicus, complete
          Length = 2394

 Score =  109 bits (55), Expect = 7e-24
 Identities = 139/167 (83%)
 Strand = Plus / Plus

                                                                        
Query: 7    gagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaaggca 66
            ||||| ||||| ||||| ||||| ||||||||| | ||||||||||| || |||||||| 
Sbjct: 1182 gagagagagattaactctgtgaatgacaaccctttgattgatgtttccagaaacaaggcc 1241

                                                                        
Query: 67   cttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcgtctc 126
             | ||||| || |||||||| || |||||||| || ||||||||||| ||||| ||||| 
Sbjct: 1242 ttacatggtggtaatttccaaggaaccccaataggagtttccatggacaacacacgtcta 1301

                                                           
Query: 127  gccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
            ||  ||||  ||||||| ||||| ||||||||||| ||||| |||||
Sbjct: 1302 gctcttgcatcaattggcaaacttatgtttgctcagttcactgagct 1348


>gnl|LJGI|TC58817 UniRef100_A0PBZ2 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
           japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
           japonicus, complete
          Length = 1458

 Score =  107 bits (54), Expect = 3e-23
 Identities = 141/170 (82%)
 Strand = Plus / Plus

                                                                       
Query: 4   atcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaag 63
           |||||||| ||||| || || ||||||||||||||| | |||||||| || || ||||||
Sbjct: 285 atcgagagagagattaattctgtgaacgacaaccctttgattgatgtctccagaaacaag 344

                                                                       
Query: 64  gcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcgt 123
           ||  | || || || |||||||| || ||||| ||||| ||||||||||| ||||| || 
Sbjct: 345 gccttgcacggtggtaatttccaaggaacccctattggagtttccatggacaacacacgc 404

                                                             
Query: 124 ctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
           || ||  |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 405 ctggcgcttgcagcaattggcaaactcatgtttgctcaattcactgagct 454


>gnl|LJGI|TC58358 homologue to UniRef100_A0PBZ4 Cluster: Phenylalanine ammonia-lyase;
            n=1; Lotus japonicus|Rep: Phenylalanine ammonia-lyase -
            Lotus japonicus, complete
          Length = 2451

 Score =  107 bits (54), Expect = 3e-23
 Identities = 141/170 (82%)
 Strand = Plus / Plus

                                                                        
Query: 4    atcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaag 63
            |||||||| ||||| || || ||||||||||||||| | |||||||| || || ||||||
Sbjct: 1258 atcgagagagagattaattctgtgaacgacaaccctttgattgatgtctccagaaacaag 1317

                                                                        
Query: 64   gcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcgt 123
            ||  | || || || |||||||| || ||||| ||||| ||||||||||| ||||| || 
Sbjct: 1318 gccttgcacggtggtaatttccaaggaacccctattggagtttccatggacaacacacgc 1377

                                                              
Query: 124  ctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
            || ||  |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1378 ctggcgcttgcagcaattggcaaactcatgtttgctcaattcactgagct 1427


>gnl|LJGI|TC64569 homologue to UniRef100_A0PBZ4 Cluster: Phenylalanine ammonia-lyase;
            n=1; Lotus japonicus|Rep: Phenylalanine ammonia-lyase -
            Lotus japonicus, partial (97%)
          Length = 2393

 Score =  101 bits (51), Expect = 2e-21
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                        
Query: 7    gagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaaggca 66
            ||||| ||||| ||||| ||||| || |||||||| || || ||||| || |||||||| 
Sbjct: 1259 gagagagagattaactccgtgaatgataaccctctgatcgacgtttccagaaacaaggcc 1318

                                                                        
Query: 67   cttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcgtctc 126
             | ||||| || ||||| || || ||||||||||| ||||||||||| ||||| || || 
Sbjct: 1319 ttacatggcggtaattttcaaggaaccccaattggagtttccatggacaacacacgacta 1378

                                                           
Query: 127  gccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
            ||  |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1379 gctcttgcagcaattggcaaactcatgtttgctcagttcactgagct 1425


>gnl|LJGI|TC61503 UniRef100_A0PBZ4 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
            japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
            japonicus, complete
          Length = 2352

 Score =  101 bits (51), Expect = 2e-21
 Identities = 141/171 (82%)
 Strand = Plus / Plus

                                                                        
Query: 3    gatcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaa 62
            |||||| || ||||| ||||| ||||| ||||||||| | ||||||||||| || |||||
Sbjct: 1267 gatcgaaagagagattaactccgtgaatgacaaccctttgattgatgtttccagaaacaa 1326

                                                                        
Query: 63   ggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcg 122
            |||  | || || || ||||| || || ||||| ||||| || |||||||| ||||| ||
Sbjct: 1327 ggccttgcacggtggtaattttcaaggaacccctattggagtgtccatggacaacacacg 1386

                                                               
Query: 123  tctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
            ||| ||  |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1387 tctggctcttgcagcaattggaaaactcatgtttgctcagttcactgagct 1437


>gnl|LJGI|TC60002 UniRef100_A0PBZ3 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
            japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
            japonicus, complete
          Length = 2322

 Score =  101 bits (51), Expect = 2e-21
 Identities = 141/171 (82%)
 Strand = Plus / Plus

                                                                        
Query: 3    gatcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaa 62
            ||||||||| ||||| || || ||||||||||||||| | ||||||||||| || |||||
Sbjct: 1084 gatcgagagagagattaattctgtgaacgacaaccctttgattgatgtttccagaaacaa 1143

                                                                        
Query: 63   ggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcg 122
             ||  | ||||| || |||||||| || |||||||| || ||||| ||||| ||||| ||
Sbjct: 1144 agccttgcatggtggtaatttccaaggaaccccaatcggagtttctatggacaacacacg 1203

                                                               
Query: 123  tctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
             || ||  |||| || ||||| ||||||||||||||||| ||||| |||||
Sbjct: 1204 cctggctcttgcagcgattggcaaactcatgtttgctcaattcactgagct 1254


>gnl|LJGI|TC59911 UniRef100_A0PBZ8 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
           japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
           japonicus, complete
          Length = 1213

 Score = 69.9 bits (35), Expect = 6e-12
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtttccatggataacactcgtctcgccattgctgcaattgggaaactcatgtttgctcat 162
           ||||||||||| ||||| ||||| ||  |||| |||||||| ||||||||||||||||| 
Sbjct: 4   gtttccatggacaacacacgtctggctcttgcagcaattggcaaactcatgtttgctcag 63

                      
Query: 163 ttcaccgagct 173
           ||||| |||||
Sbjct: 64  ttcactgagct 74