Miyakogusa Predicted Gene
- Lj0g3v0106169.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0106169.1 tr|Q58ZF0|Q58ZF0_LOTCO Phenylalanine
ammonia-lyase (Fragment) OS=Lotus corniculatus PE=2
SV=1,94.12,7e-29,Lyase_aromatic,Aromatic amino acid lyase; no
description,NULL; L-aspartase-like,L-Aspartase-like;
SU,NODE_39058_length_229_cov_712.165955.path2.1
(208 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC77778 homologue to UniRef100_Q9SMK9 Cluster: Phenylal... 359 4e-99
gnl|LJGI|TC63525 UniRef100_A0PBZ0 Cluster: Phenylalanine ammonia... 133 5e-31
gnl|LJGI|TC80800 UniRef100_A0PBZ5 Cluster: Phenylalanine ammonia... 109 7e-24
gnl|LJGI|TC58817 UniRef100_A0PBZ2 Cluster: Phenylalanine ammonia... 107 3e-23
gnl|LJGI|TC58358 homologue to UniRef100_A0PBZ4 Cluster: Phenylal... 107 3e-23
gnl|LJGI|TC64569 homologue to UniRef100_A0PBZ4 Cluster: Phenylal... 101 2e-21
gnl|LJGI|TC61503 UniRef100_A0PBZ4 Cluster: Phenylalanine ammonia... 101 2e-21
gnl|LJGI|TC60002 UniRef100_A0PBZ3 Cluster: Phenylalanine ammonia... 101 2e-21
gnl|LJGI|TC59911 UniRef100_A0PBZ8 Cluster: Phenylalanine ammonia... 70 6e-12
>gnl|LJGI|TC77778 homologue to UniRef100_Q9SMK9 Cluster: Phenylalanine ammonia-lyase
2; n=1; Cicer arietinum|Rep: Phenylalanine ammonia-lyase
2 - Cicer arietinum (Chickpea) (Garbanzo), partial (46%)
Length = 997
Score = 359 bits (181), Expect = 4e-99
Identities = 199/205 (97%)
Strand = Plus / Plus
Query: 1 atgatcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaac 60
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 252 atgatcgagagggagataaactcggtgaacgacgaccctctcattgatgtttcaaggaac 311
Query: 61 aaggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacact 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 aaggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacact 371
Query: 121 cgtctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagctcgtgacc 180
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
Sbjct: 372 cgtctcgccattgctgcaattgggaaactcatgtttgctcagttcaccgagctcgtgaac 431
Query: 181 gttttttccaacaacgttttgcctt 205
| ||||||||||||| ||||||||
Sbjct: 432 gacttttccaacaacggtttgcctt 456
>gnl|LJGI|TC63525 UniRef100_A0PBZ0 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
japonicus, complete
Length = 2384
Score = 133 bits (67), Expect = 5e-31
Identities = 145/171 (84%)
Strand = Plus / Plus
Query: 3 gatcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaa 62
||||||||| ||||| || || ||||||||||||||| | ||||||||||| || |||||
Sbjct: 1179 gatcgagagagagattaattctgtgaacgacaaccctttgattgatgtttccagaaacaa 1238
Query: 63 ggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcg 122
||| | || || || |||||||| || ||||| ||||| ||||||||||| ||||| ||
Sbjct: 1239 ggccttgcacggtggtaatttccaagggacccctattggagtttccatggacaacacacg 1298
Query: 123 tctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
||| ||| |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1299 tctggcccttgcagcaattggaaaactcatgtttgctcagttcactgagct 1349
>gnl|LJGI|TC80800 UniRef100_A0PBZ5 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
japonicus, complete
Length = 2394
Score = 109 bits (55), Expect = 7e-24
Identities = 139/167 (83%)
Strand = Plus / Plus
Query: 7 gagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaaggca 66
||||| ||||| ||||| ||||| ||||||||| | ||||||||||| || ||||||||
Sbjct: 1182 gagagagagattaactctgtgaatgacaaccctttgattgatgtttccagaaacaaggcc 1241
Query: 67 cttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcgtctc 126
| ||||| || |||||||| || |||||||| || ||||||||||| ||||| |||||
Sbjct: 1242 ttacatggtggtaatttccaaggaaccccaataggagtttccatggacaacacacgtcta 1301
Query: 127 gccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
|| |||| ||||||| ||||| ||||||||||| ||||| |||||
Sbjct: 1302 gctcttgcatcaattggcaaacttatgtttgctcagttcactgagct 1348
>gnl|LJGI|TC58817 UniRef100_A0PBZ2 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
japonicus, complete
Length = 1458
Score = 107 bits (54), Expect = 3e-23
Identities = 141/170 (82%)
Strand = Plus / Plus
Query: 4 atcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaag 63
|||||||| ||||| || || ||||||||||||||| | |||||||| || || ||||||
Sbjct: 285 atcgagagagagattaattctgtgaacgacaaccctttgattgatgtctccagaaacaag 344
Query: 64 gcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcgt 123
|| | || || || |||||||| || ||||| ||||| ||||||||||| ||||| ||
Sbjct: 345 gccttgcacggtggtaatttccaaggaacccctattggagtttccatggacaacacacgc 404
Query: 124 ctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
|| || |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 405 ctggcgcttgcagcaattggcaaactcatgtttgctcaattcactgagct 454
>gnl|LJGI|TC58358 homologue to UniRef100_A0PBZ4 Cluster: Phenylalanine ammonia-lyase;
n=1; Lotus japonicus|Rep: Phenylalanine ammonia-lyase -
Lotus japonicus, complete
Length = 2451
Score = 107 bits (54), Expect = 3e-23
Identities = 141/170 (82%)
Strand = Plus / Plus
Query: 4 atcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaag 63
|||||||| ||||| || || ||||||||||||||| | |||||||| || || ||||||
Sbjct: 1258 atcgagagagagattaattctgtgaacgacaaccctttgattgatgtctccagaaacaag 1317
Query: 64 gcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcgt 123
|| | || || || |||||||| || ||||| ||||| ||||||||||| ||||| ||
Sbjct: 1318 gccttgcacggtggtaatttccaaggaacccctattggagtttccatggacaacacacgc 1377
Query: 124 ctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
|| || |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1378 ctggcgcttgcagcaattggcaaactcatgtttgctcaattcactgagct 1427
>gnl|LJGI|TC64569 homologue to UniRef100_A0PBZ4 Cluster: Phenylalanine ammonia-lyase;
n=1; Lotus japonicus|Rep: Phenylalanine ammonia-lyase -
Lotus japonicus, partial (97%)
Length = 2393
Score = 101 bits (51), Expect = 2e-21
Identities = 138/167 (82%)
Strand = Plus / Plus
Query: 7 gagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaaggca 66
||||| ||||| ||||| ||||| || |||||||| || || ||||| || ||||||||
Sbjct: 1259 gagagagagattaactccgtgaatgataaccctctgatcgacgtttccagaaacaaggcc 1318
Query: 67 cttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcgtctc 126
| ||||| || ||||| || || ||||||||||| ||||||||||| ||||| || ||
Sbjct: 1319 ttacatggcggtaattttcaaggaaccccaattggagtttccatggacaacacacgacta 1378
Query: 127 gccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
|| |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1379 gctcttgcagcaattggcaaactcatgtttgctcagttcactgagct 1425
>gnl|LJGI|TC61503 UniRef100_A0PBZ4 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
japonicus, complete
Length = 2352
Score = 101 bits (51), Expect = 2e-21
Identities = 141/171 (82%)
Strand = Plus / Plus
Query: 3 gatcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaa 62
|||||| || ||||| ||||| ||||| ||||||||| | ||||||||||| || |||||
Sbjct: 1267 gatcgaaagagagattaactccgtgaatgacaaccctttgattgatgtttccagaaacaa 1326
Query: 63 ggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcg 122
||| | || || || ||||| || || ||||| ||||| || |||||||| ||||| ||
Sbjct: 1327 ggccttgcacggtggtaattttcaaggaacccctattggagtgtccatggacaacacacg 1386
Query: 123 tctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
||| || |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1387 tctggctcttgcagcaattggaaaactcatgtttgctcagttcactgagct 1437
>gnl|LJGI|TC60002 UniRef100_A0PBZ3 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
japonicus, complete
Length = 2322
Score = 101 bits (51), Expect = 2e-21
Identities = 141/171 (82%)
Strand = Plus / Plus
Query: 3 gatcgagagggagataaactcggtgaacgacaaccctctcattgatgtttcaaggaacaa 62
||||||||| ||||| || || ||||||||||||||| | ||||||||||| || |||||
Sbjct: 1084 gatcgagagagagattaattctgtgaacgacaaccctttgattgatgtttccagaaacaa 1143
Query: 63 ggcacttcatggagggaatttccagggcaccccaattggtgtttccatggataacactcg 122
|| | ||||| || |||||||| || |||||||| || ||||| ||||| ||||| ||
Sbjct: 1144 agccttgcatggtggtaatttccaaggaaccccaatcggagtttctatggacaacacacg 1203
Query: 123 tctcgccattgctgcaattgggaaactcatgtttgctcatttcaccgagct 173
|| || |||| || ||||| ||||||||||||||||| ||||| |||||
Sbjct: 1204 cctggctcttgcagcgattggcaaactcatgtttgctcaattcactgagct 1254
>gnl|LJGI|TC59911 UniRef100_A0PBZ8 Cluster: Phenylalanine ammonia-lyase; n=1; Lotus
japonicus|Rep: Phenylalanine ammonia-lyase - Lotus
japonicus, complete
Length = 1213
Score = 69.9 bits (35), Expect = 6e-12
Identities = 62/71 (87%)
Strand = Plus / Plus
Query: 103 gtttccatggataacactcgtctcgccattgctgcaattgggaaactcatgtttgctcat 162
||||||||||| ||||| ||||| || |||| |||||||| |||||||||||||||||
Sbjct: 4 gtttccatggacaacacacgtctggctcttgcagcaattggcaaactcatgtttgctcag 63
Query: 163 ttcaccgagct 173
||||| |||||
Sbjct: 64 ttcactgagct 74