Miyakogusa Predicted Gene

Lj0g3v0105189.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0105189.1 Non Chatacterized Hit- tr|Q84W64|Q84W64_ARATH
Putative uncharacterized protein At3g20520 OS=Arabidop,33.33,8e-19,no
description,PLC-like phosphodiesterase, TIM beta/alpha-barrel domain;
GDPD,Glycerophosphoryl dies,CUFF.6008.1
         (559 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS351721 weakly similar to UniRef100_Q8GXJ8 Cluster: GP...    60   2e-08

>gnl|LJGI|FS351721 weakly similar to UniRef100_Q8GXJ8 Cluster: GPI-anchored protein;
           n=1; Arabidopsis thaliana|Rep: GPI-anchored protein -
           Arabidopsis thaliana (Mouse-ear cress), partial (25%)
          Length = 612

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                       
Query: 451 tactggtcagatcctaatatcgagatggctacttatgtccatactgttcaggttgacggg 510
           ||||||||||| |||||| | ||||| ||||||||  ||||| |||   ||||||| || 
Sbjct: 564 tactggtcagaccctaatgtggagattgctacttacatccattctgccaaggttgatgga 505

                                             
Query: 511 ctcgtgactgaatttccagccactgcaagtagat 544
            | |||||||| |||||||||||||| |||||||
Sbjct: 504 atagtgactgattttccagccactgctagtagat 471