Miyakogusa Predicted Gene

Lj0g3v0105159.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0105159.1 tr|A9RQS3|A9RQS3_PHYPA Predicted protein
OS=Physcomitrella patens subsp. patens
GN=PHYPADRAFT_160518,32.35,0.000000000000002,no description,PLC-like
phosphodiesterase, TIM beta/alpha-barrel domain; seg,NULL; PLC-like
phosphod,CUFF.5985.1
         (774 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC73742                                                       76   4e-13

>gnl|LJGI|TC73742 
          Length = 752

 Score = 75.8 bits (38), Expect = 4e-13
 Identities = 50/54 (92%)
 Strand = Plus / Plus

                                                                 
Query: 146 aatccccaccaaggttttggttgaatgttcagaatgcagcattctacacccaac 199
           |||| ||||||||||||||||||||||||||| ||| ||||||||||| |||||
Sbjct: 629 aatctccaccaaggttttggttgaatgttcagtatgaagcattctacaaccaac 682