Miyakogusa Predicted Gene

Lj0g3v0104969.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0104969.1 tr|G4T0T9|G4T0T9_META2 Permease YjgP/YjgQ family
protein OS=Methylomicrobium alcaliphilum (strain DS,35.29,4.7,
,CUFF.5966.1
         (235 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58672 weakly similar to UniRef100_Q6GLC1 Cluster: LUC...   196   4e-50

>gnl|LJGI|TC58672 weakly similar to UniRef100_Q6GLC1 Cluster: LUC7-like; n=1; Xenopus
           tropicalis|Rep: LUC7-like - Xenopus tropicalis (Western
           clawed frog) (Silurana tropicalis), partial (7%)
          Length = 788

 Score =  196 bits (99), Expect = 4e-50
 Identities = 172/195 (88%), Gaps = 1/195 (0%)
 Strand = Plus / Plus

                                                                       
Query: 34  gtcttgctctgcgtttggtggcgttatcgtccgcctcctttt-tcagtcgttctcgctgc 92
           |||||||||||||||||||| |||| ||||||||||| |||| ||||||| |||||||||
Sbjct: 178 gtcttgctctgcgtttggtgtcgttctcgtccgcctctttttttcagtcgctctcgctgc 237

                                                                       
Query: 93  tgtttcgtttttggggtcgtgttacagatctggcttcgttggttctttcagatccgacat 152
           |  ||||||  |||||| |||||||| ||||| ||||||||||||||| ||||| | | |
Sbjct: 238 tagttcgttgctggggttgtgttacatatctgacttcgttggttcttttagatctggcct 297

                                                                       
Query: 153 cattgggtccggtggtggctggcttgttcgtgggtctatgccaaacaatgtcggcggtgg 212
           | |||||| ||||||||| ||||||||||||||||||||||| |||||||| ||  ||||
Sbjct: 298 ctttgggttcggtggtggttggcttgttcgtgggtctatgccgaacaatgttggatgtgg 357

                          
Query: 213 ttcttggggcgtgcg 227
           |||||||||||||||
Sbjct: 358 ttcttggggcgtgcg 372