Miyakogusa Predicted Gene

Lj0g3v0104799.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0104799.1 CUFF.5956.1
         (363 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP038702 weakly similar to UniRef100_Q7VB11 Cluster: Pr...    66   2e-10

>gnl|LJGI|BP038702 weakly similar to UniRef100_Q7VB11 Cluster: Predicted protein
          family PM-13; n=1; Prochlorococcus marinus|Rep:
          Predicted protein family PM-13 - Prochlorococcus
          marinus, partial (6%)
          Length = 514

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                               
Query: 1  atgatggattatttaatccaccctatagatgatggat 37
          ||||||||||||||||||||||||||| |||||||||
Sbjct: 55 atgatggattatttaatccaccctataaatgatggat 19