Miyakogusa Predicted Gene

Lj0g3v0104279.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0104279.1 Non Chatacterized Hit- tr|I1N4D7|I1N4D7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.39883 PE,84.55,0,ATPases
associated with a variety of cellula,AAA+ ATPase domain; no
description,NULL; seg,NULL; P-lo,CUFF.5919.1
         (963 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67783 homologue to UniRef100_A7PJL7 Cluster: Chromoso...    86   5e-16
gnl|LJGI|TC67690 homologue to UniRef100_A7NVT2 Cluster: Chromoso...    60   3e-08

>gnl|LJGI|TC67783 homologue to UniRef100_A7PJL7 Cluster: Chromosome chr12
           scaffold_18, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr12 scaffold_18, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (69%)
          Length = 1543

 Score = 85.7 bits (43), Expect = 5e-16
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 583 tttcagatggaaccaaatacaggagtgacatttgatgatgtggctggagttgatgaagcc 642
           ||||||||||||||||| || |||||||||||||||||||| || || || |||||||||
Sbjct: 678 tttcagatggaaccaaacactggagtgacatttgatgatgttgccggggtggatgaagcc 737

                      
Query: 643 aagcaagattt 653
           ||||| |||||
Sbjct: 738 aagcaggattt 748


>gnl|LJGI|TC67690 homologue to UniRef100_A7NVT2 Cluster: Chromosome chr18 scaffold_1,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_1, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (52%)
          Length = 1861

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 907 ttcattgatgagatagatgctgtggggaggcagagagg 944
           |||||||||||||| |||||||| ||||||||||||||
Sbjct: 29  ttcattgatgagattgatgctgttgggaggcagagagg 66