Miyakogusa Predicted Gene

Lj0g3v0103509.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0103509.1 Non Chatacterized Hit- tr|F4KWW2|F4KWW2_HALH1
Putative uncharacterized protein (Precursor)
OS=Halisc,44,4.2,seg,NULL,CUFF.5869.1
         (186 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC600028 similar to UniRef100_A6LRR2 Cluster: Peptidase...   248   1e-65
gnl|LJGI|AV777802                                                      82   1e-15

>gnl|LJGI|DC600028 similar to UniRef100_A6LRR2 Cluster: Peptidase S8 and S53,
           subtilisin, kexin, sedolisin; n=1; Clostridium
           beijerinckii NCIMB 8052|Rep: Peptidase S8 and S53,
           subtilisin, kexin, sedolisin - Clostridium beijerinckii
           NCIMB 8052, partial (3%)
          Length = 579

 Score =  248 bits (125), Expect = 1e-65
 Identities = 125/125 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgatgtatgtgcctgctgttgattttcttggcgggagcctgcaattgactctttcaggc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 atgatgtatgtgcctgctgttgattttcttggcgggagcctgcaattgactctttcaggc 514

                                                                       
Query: 61  ggggagccttctatgggtaatttcaggcgggagcctgctattgattcttttaggcgggga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 515 ggggagccttctatgggtaatttcaggcgggagcctgctattgattcttttaggcgggga 574

                
Query: 121 gccta 125
           |||||
Sbjct: 575 gccta 579


>gnl|LJGI|AV777802 
          Length = 147

 Score = 81.8 bits (41), Expect = 1e-15
 Identities = 41/41 (100%)
 Strand = Plus / Minus

                                                    
Query: 146 ctgtttacaagcagagagtttgtttttgttcttctatttga 186
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 147 ctgtttacaagcagagagtttgtttttgttcttctatttga 107