Miyakogusa Predicted Gene

Lj0g3v0103069.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0103069.1 tr|F2DWA7|F2DWA7_HORVD Predicted protein
OS=Hordeum vulgare var. distichum PE=2 SV=1,32.5,8e-19,seg,NULL;
DUF581,Protein of unknown function DUF581,CUFF.5823.1
         (858 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV417976                                                     100   3e-20
gnl|LJGI|TC79779 similar to UniRef100_A7NWQ3 Cluster: Chromosome...   100   3e-20
gnl|LJGI|TC69601 similar to UniRef100_A3I4V4 Cluster: Sensory bo...   100   3e-20

>gnl|LJGI|AV417976 
          Length = 347

 Score = 99.6 bits (50), Expect = 3e-20
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 ccatctctatttggatcacaaaaattgagagatttcaccatgaagtgtctctcaggagga 162
           |||||||||||||| |||| ||| || ||||| |||||||  ||||||||||| | ||||
Sbjct: 199 ccatctctatttggctcaccaaagtttagagacttcaccaacaagtgtctctctgcagga 258

                                                     
Query: 163 gctgaggctttgagaagccccacatcaattcttgacaccaga 204
            |||| |||||||||||||| || ||||||||||||||||||
Sbjct: 259 actgatgctttgagaagcccaacttcaattcttgacaccaga 300


>gnl|LJGI|TC79779 similar to UniRef100_A7NWQ3 Cluster: Chromosome chr5 scaffold_2,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_2, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (12%)
          Length = 1099

 Score = 99.6 bits (50), Expect = 3e-20
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 736 tgttatacttgcaagaagcatcttgaacagacaaaagacatctttatttacaggggagaa 795
           ||||| ||||||||||| |||||||| |||||||||||||||||||||||  | ||||| 
Sbjct: 405 tgttacacttgcaagaaacatcttgagcagacaaaagacatctttatttatggaggagag 464

                                                             
Query: 796 aaagccttctgcagccaagaatgtcgccaccaagagatggtgttagatgg 845
           ||||| ||||||||   |||||| ||||||  ||| ||||||||||||||
Sbjct: 465 aaagctttctgcagtagagaatgccgccacagagaaatggtgttagatgg 514


>gnl|LJGI|TC69601 similar to UniRef100_A3I4V4 Cluster: Sensory box/GGDEF family
           protein; n=1; Bacillus sp. B14905|Rep: Sensory box/GGDEF
           family protein - Bacillus sp. B14905, partial (3%)
          Length = 833

 Score = 99.6 bits (50), Expect = 3e-20
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 ccatctctatttggatcacaaaaattgagagatttcaccatgaagtgtctctcaggagga 162
           |||||||||||||| |||| ||| || ||||| |||||||  ||||||||||| | ||||
Sbjct: 600 ccatctctatttggctcaccaaagtttagagacttcaccaacaagtgtctctctgcagga 659

                                                     
Query: 163 gctgaggctttgagaagccccacatcaattcttgacaccaga 204
            |||| |||||||||||||| || ||||||||||||||||||
Sbjct: 660 actgatgctttgagaagcccaacttcaattcttgacaccaga 701



 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 298 tcaaaaggaattggccttgctcttgtgggtga 329
           |||||||| |||||||||||||||||||||||
Sbjct: 801 tcaaaaggcattggccttgctcttgtgggtga 832