Miyakogusa Predicted Gene

Lj0g3v0102189.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0102189.1 tr|G7ZYM9|G7ZYM9_MEDTR FBD-associated F-box
protein OS=Medicago truncatula GN=MTR_076s0012 PE=4
SV=1,35.84,9e-18,domain in FBox and BRCT domain containing pl,FBD;
FBD,FBD,CUFF.5758.1
         (543 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77884                                                       60   1e-08
gnl|LJGI|TC76992 similar to UniRef100_A0KCX4 Cluster: Binding-pr...    56   2e-07

>gnl|LJGI|TC77884 
          Length = 548

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 30/30 (100%)
 Strand = Plus / Plus

                                         
Query: 261 agaacttgttccagaatgtgtttcattaca 290
           ||||||||||||||||||||||||||||||
Sbjct: 110 agaacttgttccagaatgtgtttcattaca 139



 Score = 58.0 bits (29), Expect = 6e-08
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 93  ctgggatggagtactggaagttctctcttactgtcccaagcttcaaaatcttgccataga 152
           ||||| ||| ||| ||||||| ||| |||| |||||||||||||||| ||||| ||| ||
Sbjct: 2   ctgggttggtgtaatggaagtgctcccttattgtcccaagcttcaaactcttgacattga 61

                
Query: 153 aaagc 157
           |||||
Sbjct: 62  aaagc 66


>gnl|LJGI|TC76992 similar to UniRef100_A0KCX4 Cluster: Binding-protein-dependent
           transport systems inner membrane component; n=2;
           Burkholderia cenocepacia|Rep: Binding-protein-dependent
           transport systems inner membrane component -
           Burkholderia cenocepacia (strain HI2424), partial (5%)
          Length = 1195

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 93  ctgggatggagtactggaagttctctcttactgtcccaagcttcaaaatcttgccataga 152
           ||||| ||| ||| ||||||  ||| |||| |||||||||||||||| ||||||||| ||
Sbjct: 595 ctgggttggtgtaatggaagcgctcccttattgtcccaagcttcaaactcttgccattga 654

               
Query: 153 aaag 156
           ||||
Sbjct: 655 aaag 658