Miyakogusa Predicted Gene

Lj0g3v0101539.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0101539.1 Non Chatacterized Hit- tr|I1MW66|I1MW66_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.27788
PE,85.45,0,Ribonuclease H-like,Ribonuclease H-like domain; no
description,NULL; DNA_pol_A_exo1,3'-5' exonucleas,CUFF.5705.1
         (684 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62119 similar to UniRef100_Q9FFL2 Cluster: Nucleolar ...   527   e-149
gnl|LJGI|AV773940 similar to UniRef100_A7QRH3 Cluster: Chromosom...    90   2e-17

>gnl|LJGI|TC62119 similar to UniRef100_Q9FFL2 Cluster: Nucleolar protein-like; n=1;
           Arabidopsis thaliana|Rep: Nucleolar protein-like -
           Arabidopsis thaliana (Mouse-ear cress), partial (11%)
          Length = 749

 Score =  527 bits (266), Expect = e-149
 Identities = 273/274 (99%), Gaps = 1/274 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagtcccgcagtggcggacagcgttaaggtggcggtgaaagataagaagactactggg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 476 atgagtcccgcagtggcggacagcgttaaggtggcggtgaaagataagaagactactggg 535

                                                                       
Query: 61  ccgaagcctaaggtgccttttcatataccgaccattaggaggccacaggatgagtataac 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 536 ccgaagcctaaggtgccttttcatataccgaccattaggaggccacaggatgagtataac 595

                                                                       
Query: 121 attctggttaataataccaacatgccttttgaacatgtttggttgcagaggagtgaggat 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 596 attctggttaataataccaacatgccttttgaacatgtttggttgcagaggagtgaggat 655

                                                                       
Query: 181 ggtgacaggtttattcatccactggaaaagatctttgtattggattttgttgataaagat 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 656 ggtgacaggtttattcatccactggaaaagatctttgtattggattttgttgataaagat 715

                                             
Query: 241 -cctggggatgttctgccaaagaagcctccccca 273
            |||||||||||||||||||||||||||||||||
Sbjct: 716 ccctggggatgttctgccaaagaagcctccccca 749


>gnl|LJGI|AV773940 similar to UniRef100_A7QRH3 Cluster: Chromosome chr8 scaffold_150,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_150, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (15%)
          Length = 455

 Score = 89.7 bits (45), Expect = 2e-17
 Identities = 144/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 187 aggtttattcatccactggaaaagatctttgtattggattttgttgataaagatcctggg 246
           |||||||||||||||||||| ||  |||  || ||||||||||| || ||||||| || |
Sbjct: 431 aggtttattcatccactggagaaactctcggttttggattttgtagacaaagatcttgag 372

                                                                       
Query: 247 gatgttctgccaaagaagcctcccccaatagaaagcactcctttcaagcttgtggaggaa 306
            || || | |||   |||||||||||| | ||| |||| |||||| ||||||||||||| 
Sbjct: 371 aatcttgtaccagtcaagcctcccccacttgaatgcacccctttccagcttgtggaggat 312

                                                                    
Query: 307 gtcaaagatttgaaagacctggctgctaagctgcgttctgttgatgaatttgcggta 363
           |||||||  ||||| ||  ||||| ||||||||  ||| ||| ||||||||||||||
Sbjct: 311 gtcaaaggcttgaaggagttggctactaagctgtattcagttaatgaatttgcggta 255