Miyakogusa Predicted Gene

Lj0g3v0101039.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0101039.1 tr|A8J1B8|A8J1B8_CHLRE ARF-GAP protein
OS=Chlamydomonas reinhardtii GN=CHLREDRAFT_149716 PE=4
SV=1,79.59,3e-17,ARFGAP,Arf GTPase activating protein;
ArfGap/RecO-like zinc finger,NULL; ArfGap,Arf GTPase
activatin,CUFF.5794.1
         (165 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC60779 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase...   311   7e-85
gnl|LJGI|TC78145 homologue to UniRef100_Q2HVU4 Cluster: Arf GTPa...   137   2e-32
gnl|LJGI|TC81037                                                       70   4e-12

>gnl|LJGI|TC60779 similar to UniRef100_Q2HVU4 Cluster: Arf GTPase activating protein;
           n=1; Medicago truncatula|Rep: Arf GTPase activating
           protein - Medicago truncatula (Barrel medic), partial
           (50%)
          Length = 871

 Score =  311 bits (157), Expect = 7e-85
 Identities = 163/165 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcggcgtcgcggcggctccgggagctgcaatcgatgccggggaacaagatctgcgtt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 60  atggcggcgtcgcggcggctccgggagctgcaatcgatgccggggaacaagatctgcgtt 119

                                                                       
Query: 61  gactgttcccagaagaatcctcagtgggcctccgtctcctacggcatcttcatgtgtctc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120 gactgttcccagaagaatcctcagtgggcctccgtctcctacggcatcttcatgtgtctc 179

                                                        
Query: 121 gagtgctccggcaagcaccgcggcctcggcggccacctctccttc 165
           ||||||||||||||||||||||||||||||| |||| ||||||||
Sbjct: 180 gagtgctccggcaagcaccgcggcctcggcgtccacatctccttc 224


>gnl|LJGI|TC78145 homologue to UniRef100_Q2HVU4 Cluster: Arf GTPase activating
           protein; n=1; Medicago truncatula|Rep: Arf GTPase
           activating protein - Medicago truncatula (Barrel medic),
           partial (25%)
          Length = 481

 Score =  137 bits (69), Expect = 2e-32
 Identities = 141/165 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcggcgtcgcggcggctccgggagctgcaatcgatgccggggaacaagatctgcgtt 60
           ||||||||||| |||||||||||||| || |||||   |||    |||||||||||||| 
Sbjct: 147 atggcggcgtcacggcggctccgggatctccaatccgagccctccaacaagatctgcgtc 206

                                                                       
Query: 61  gactgttcccagaagaatcctcagtgggcctccgtctcctacggcatcttcatgtgtctc 120
           ||||| ||||| || || || || ||||||||||||||||||||| |||||||||| |||
Sbjct: 207 gactgctcccaaaaaaacccccaatgggcctccgtctcctacggcgtcttcatgtgcctc 266

                                                        
Query: 121 gagtgctccggcaagcaccgcggcctcggcggccacctctccttc 165
           || ||||||||||| |||||||||||||| | |||| ||||||||
Sbjct: 267 gaatgctccggcaaacaccgcggcctcggtgtccacatctccttc 311


>gnl|LJGI|TC81037 
          Length = 782

 Score = 69.9 bits (35), Expect = 4e-12
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  ggagctgcaatcgatgccggggaacaagatctgcgttgactgttcccagaagaatcctca 83
           |||| |||||||||||||| |||||||||||| ||  | ||| | ||||||||| | | |
Sbjct: 133 ggagttgcaatcgatgccgaggaacaagatcttcgcgggctgcttccagaagaaccttta 192

                                          
Query: 84  gtgggcctccgtctcctacggcatcttcatg 114
           ||||||||||| |||||||  ||||||||||
Sbjct: 193 gtgggcctccgcctcctacaacatcttcatg 223