Miyakogusa Predicted Gene
- Lj0g3v0100629.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0100629.1 Non Chatacterized Hit- tr|B9SEW6|B9SEW6_RICCO
Multiprotein-bridging factor, putative OS=Ricinus
comm,87.27,2e-19,ENDOTHELIAL DIFFERENTIATION-RELATED FACTOR 1
(MULTIPROTEIN BRIDGING FACTOR 1),NULL; HTH_CROC1,Helix-,CUFF.5638.1
(168 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO024098 similar to UniRef100_A0MWB6 Cluster: Transcrip... 333 2e-91
gnl|LJGI|BW595247 similar to UniRef100_Q152U8 Cluster: Multiprot... 210 2e-54
gnl|LJGI|TC61262 210 2e-54
gnl|LJGI|TC71996 202 5e-52
gnl|LJGI|GO024959 homologue to UniRef100_Q152U8 Cluster: Multipr... 137 2e-32
>gnl|LJGI|GO024098 similar to UniRef100_A0MWB6 Cluster: Transcriptional coactivator
multiprotein bridging factor; n=1; Solanum
lycopersicum|Rep: Transcriptional coactivator
multiprotein bridging factor - Solanum lycopersicum
(Tomato) (Lycopersicon esculentum), partial (52%)
Length = 449
Score = 333 bits (168), Expect = 2e-91
Identities = 168/168 (100%)
Strand = Plus / Plus
Query: 1 atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 103 atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 162
Query: 61 aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 163 aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 222
Query: 121 ggcaagttggagagagcccttggagctaaactgcgtggcaataaataa 168
||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 223 ggcaagttggagagagcccttggagctaaactgcgtggcaataaataa 270
>gnl|LJGI|BW595247 similar to UniRef100_Q152U8 Cluster: Multiprotein bridging factor
1b; n=1; Solanum lycopersicum|Rep: Multiprotein bridging
factor 1b - Solanum lycopersicum (Tomato) (Lycopersicon
esculentum), partial (87%)
Length = 472
Score = 210 bits (106), Expect = 2e-54
Identities = 151/166 (90%)
Strand = Plus / Plus
Query: 1 atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 60
|||||||| ||||||| |||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 302 atgcaagcccggatggataagaaattaactcaggctcaacttgctcagataatcaatgag 361
Query: 61 aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 120
||||||||||||||||| ||||||||||||||||| || ||||||||||||||| |||||
Sbjct: 362 aagcctcaagtgatccaggagtatgagtcagggaaagcgattccaaaccagcagattatt 421
Query: 121 ggcaagttggagagagcccttggagctaaactgcgtggcaataaat 166
||||| ||||||||||||||||| || |||||||||||||| ||||
Sbjct: 422 ggcaaattggagagagcccttggtgccaaactgcgtggcaagaaat 467
>gnl|LJGI|TC61262
Length = 749
Score = 210 bits (106), Expect = 2e-54
Identities = 151/166 (90%)
Strand = Plus / Plus
Query: 1 atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 60
|||||||| ||||||| |||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 335 atgcaagcccggatggataagaaattaactcaggctcaacttgctcagataatcaatgag 394
Query: 61 aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 120
||||||||||||||||| ||||||||||||||||| || ||||||||||||||| |||||
Sbjct: 395 aagcctcaagtgatccaggagtatgagtcagggaaagcgattccaaaccagcagattatt 454
Query: 121 ggcaagttggagagagcccttggagctaaactgcgtggcaataaat 166
||||| ||||||||||||||||| || |||||||||||||| ||||
Sbjct: 455 ggcaaattggagagagcccttggtgccaaactgcgtggcaagaaat 500
>gnl|LJGI|TC71996
Length = 734
Score = 202 bits (102), Expect = 5e-52
Identities = 150/166 (90%)
Strand = Plus / Plus
Query: 1 atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 60
|||||||| ||||||| |||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 379 atgcaagcccggatggataagaaattaactcaggctcaacttgctcagataatcaatgag 438
Query: 61 aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 120
||||||||||||||||| ||||||||||||||||| || ||||||||||||||| |||||
Sbjct: 439 aagcctcaagtgatccaggagtatgagtcagggaaagcgattccaaaccagcagattatt 498
Query: 121 ggcaagttggagagagcccttggagctaaactgcgtggcaataaat 166
||||| ||||||||||||||||| || ||||||| |||||| ||||
Sbjct: 499 ggcaaattggagagagcccttggtgccaaactgcctggcaagaaat 544
>gnl|LJGI|GO024959 homologue to UniRef100_Q152U8 Cluster: Multiprotein bridging factor
1b; n=1; Solanum lycopersicum|Rep: Multiprotein bridging
factor 1b - Solanum lycopersicum (Tomato) (Lycopersicon
esculentum), partial (53%)
Length = 491
Score = 137 bits (69), Expect = 2e-32
Identities = 93/101 (92%)
Strand = Plus / Plus
Query: 66 tcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttattggcaa 125
|||||||||||| ||||||||||||||||| || ||||||||||||||| ||||||||||
Sbjct: 180 tcaagtgatccaggagtatgagtcagggaaagcgattccaaaccagcagattattggcaa 239
Query: 126 gttggagagagcccttggagctaaactgcgtggcaataaat 166
||||||||||||||||| || |||||||||||||| ||||
Sbjct: 240 attggagagagcccttggtgccaaactgcgtggcaagaaat 280