Miyakogusa Predicted Gene

Lj0g3v0100629.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0100629.1 Non Chatacterized Hit- tr|B9SEW6|B9SEW6_RICCO
Multiprotein-bridging factor, putative OS=Ricinus
comm,87.27,2e-19,ENDOTHELIAL DIFFERENTIATION-RELATED FACTOR 1
(MULTIPROTEIN BRIDGING FACTOR 1),NULL; HTH_CROC1,Helix-,CUFF.5638.1
         (168 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO024098 similar to UniRef100_A0MWB6 Cluster: Transcrip...   333   2e-91
gnl|LJGI|BW595247 similar to UniRef100_Q152U8 Cluster: Multiprot...   210   2e-54
gnl|LJGI|TC61262                                                      210   2e-54
gnl|LJGI|TC71996                                                      202   5e-52
gnl|LJGI|GO024959 homologue to UniRef100_Q152U8 Cluster: Multipr...   137   2e-32

>gnl|LJGI|GO024098 similar to UniRef100_A0MWB6 Cluster: Transcriptional coactivator
           multiprotein bridging factor; n=1; Solanum
           lycopersicum|Rep: Transcriptional coactivator
           multiprotein bridging factor - Solanum lycopersicum
           (Tomato) (Lycopersicon esculentum), partial (52%)
          Length = 449

 Score =  333 bits (168), Expect = 2e-91
 Identities = 168/168 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 103 atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 162

                                                                       
Query: 61  aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 163 aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 222

                                                           
Query: 121 ggcaagttggagagagcccttggagctaaactgcgtggcaataaataa 168
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 223 ggcaagttggagagagcccttggagctaaactgcgtggcaataaataa 270


>gnl|LJGI|BW595247 similar to UniRef100_Q152U8 Cluster: Multiprotein bridging factor
           1b; n=1; Solanum lycopersicum|Rep: Multiprotein bridging
           factor 1b - Solanum lycopersicum (Tomato) (Lycopersicon
           esculentum), partial (87%)
          Length = 472

 Score =  210 bits (106), Expect = 2e-54
 Identities = 151/166 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 60
           ||||||||  ||||||| |||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 302 atgcaagcccggatggataagaaattaactcaggctcaacttgctcagataatcaatgag 361

                                                                       
Query: 61  aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 120
           ||||||||||||||||| ||||||||||||||||| || ||||||||||||||| |||||
Sbjct: 362 aagcctcaagtgatccaggagtatgagtcagggaaagcgattccaaaccagcagattatt 421

                                                         
Query: 121 ggcaagttggagagagcccttggagctaaactgcgtggcaataaat 166
           ||||| ||||||||||||||||| || |||||||||||||| ||||
Sbjct: 422 ggcaaattggagagagcccttggtgccaaactgcgtggcaagaaat 467


>gnl|LJGI|TC61262 
          Length = 749

 Score =  210 bits (106), Expect = 2e-54
 Identities = 151/166 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 60
           ||||||||  ||||||| |||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 335 atgcaagcccggatggataagaaattaactcaggctcaacttgctcagataatcaatgag 394

                                                                       
Query: 61  aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 120
           ||||||||||||||||| ||||||||||||||||| || ||||||||||||||| |||||
Sbjct: 395 aagcctcaagtgatccaggagtatgagtcagggaaagcgattccaaaccagcagattatt 454

                                                         
Query: 121 ggcaagttggagagagcccttggagctaaactgcgtggcaataaat 166
           ||||| ||||||||||||||||| || |||||||||||||| ||||
Sbjct: 455 ggcaaattggagagagcccttggtgccaaactgcgtggcaagaaat 500


>gnl|LJGI|TC71996 
          Length = 734

 Score =  202 bits (102), Expect = 5e-52
 Identities = 150/166 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcaagctaggatggacaagaaacttactcaggctcagcttgctcaaataatcaatgag 60
           ||||||||  ||||||| |||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 379 atgcaagcccggatggataagaaattaactcaggctcaacttgctcagataatcaatgag 438

                                                                       
Query: 61  aagcctcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttatt 120
           ||||||||||||||||| ||||||||||||||||| || ||||||||||||||| |||||
Sbjct: 439 aagcctcaagtgatccaggagtatgagtcagggaaagcgattccaaaccagcagattatt 498

                                                         
Query: 121 ggcaagttggagagagcccttggagctaaactgcgtggcaataaat 166
           ||||| ||||||||||||||||| || ||||||| |||||| ||||
Sbjct: 499 ggcaaattggagagagcccttggtgccaaactgcctggcaagaaat 544


>gnl|LJGI|GO024959 homologue to UniRef100_Q152U8 Cluster: Multiprotein bridging factor
           1b; n=1; Solanum lycopersicum|Rep: Multiprotein bridging
           factor 1b - Solanum lycopersicum (Tomato) (Lycopersicon
           esculentum), partial (53%)
          Length = 491

 Score =  137 bits (69), Expect = 2e-32
 Identities = 93/101 (92%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagtgatccaagagtatgagtcagggaaggcaattccaaaccagcaggttattggcaa 125
           |||||||||||| ||||||||||||||||| || ||||||||||||||| ||||||||||
Sbjct: 180 tcaagtgatccaggagtatgagtcagggaaagcgattccaaaccagcagattattggcaa 239

                                                    
Query: 126 gttggagagagcccttggagctaaactgcgtggcaataaat 166
            ||||||||||||||||| || |||||||||||||| ||||
Sbjct: 240 attggagagagcccttggtgccaaactgcgtggcaagaaat 280