Miyakogusa Predicted Gene

Lj0g3v0099619.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0099619.1 Non Chatacterized Hit- tr|B9T9Z1|B9T9Z1_RICCO
Putative uncharacterized protein OS=Ricinus communis G,80.77,0.002,
,CUFF.5617.1
         (293 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO022328 UniRef100_P05502 Cluster: Cytochrome c oxidase...    82   2e-15
gnl|LJGI|BP084612                                                      74   5e-13

>gnl|LJGI|GO022328 UniRef100_P05502 Cluster: Cytochrome c oxidase subunit 1; n=2;
           Sorghum bicolor|Rep: Cytochrome c oxidase subunit 1 -
           Sorghum bicolor (Sorghum) (Sorghum vulgare), partial
           (42%)
          Length = 704

 Score = 81.8 bits (41), Expect = 2e-15
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                       
Query: 13  atgaaatgtagagtccctatatcgttgtggttagtggagaacagccaccggacaggattt 72
           ||||||| ||||||||||||||| ||||||||||||||||||||||| || ||  |||||
Sbjct: 104 atgaaatatagagtccctatatccttgtggttagtggagaacagccatcgaaccagattt 45

                        
Query: 73  ctcgtaaaatgga 85
            || |||||||||
Sbjct: 44  gtcataaaatgga 32


>gnl|LJGI|BP084612 
          Length = 481

 Score = 73.8 bits (37), Expect = 5e-13
 Identities = 37/37 (100%)
 Strand = Plus / Minus

                                                
Query: 257 ttgcgtctagtggggagctttgtcatctcaaataatt 293
           |||||||||||||||||||||||||||||||||||||
Sbjct: 481 ttgcgtctagtggggagctttgtcatctcaaataatt 445