Miyakogusa Predicted Gene

Lj0g3v0097919.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0097919.1 tr|G7KD27|G7KD27_MEDTR Ribosomal RNA small
subunit methyltransferase B OS=Medicago truncatula
GN=MTR,53.85,0.000005, ,CUFF.5466.1
         (279 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS332356 similar to UniRef100_UPI00005F83E6 Cluster: CO...   381   e-105

>gnl|LJGI|FS332356 similar to UniRef100_UPI00005F83E6 Cluster: COG0697: Permeases of
           the drug/metabolite transporter (DMT) superfamily; n=1;
           Yersinia mollaretii ATCC 43969|Rep: COG0697: Permeases
           of the drug/metabolite transporter (DMT) superfamily -
           Yersinia mollaretii ATCC 43969, partial (5%)
          Length = 729

 Score =  381 bits (192), Expect = e-105
 Identities = 216/224 (96%)
 Strand = Plus / Plus

                                                                       
Query: 16  gggtttgggtattttatctgttatctaaaagcaatgagggcgagtgaagcagcaagcacc 75
           ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||
Sbjct: 506 gggtttgggtattttatctgtcatctaaaagcgatgagggcgagtgaagcagcaagcacc 565

                                                                       
Query: 76  attgaacgccgagtggtgaaccctttgaatgagtctcacggtttcgatgctgctctttcc 135
           |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 566 attgaacgccaattggtgaaccctttgaatgagtctcacggtttcgatgctgctctttcc 625

                                                                       
Query: 136 atgtgtcgcattcctaacctcgattatgtcgtgtttctttggtgttcaacaccgcaacac 195
           ||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||| |||
Sbjct: 626 atgtggcgcgttcctaacctcgattatgtcgcgtttctttggtgttcaacaccgcagcac 685

                                                       
Query: 196 attgattatggtggtgaatcactgcgcatggaggtcaatgttag 239
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 686 attgattatggtggtgaatcactgcgcatggaggtcaatgttag 729